ID: 977331943

View in Genome Browser
Species Human (GRCh38)
Location 4:95647401-95647423
Sequence TTTGGTAAGCAGCAGCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977331943_977331945 -5 Left 977331943 4:95647401-95647423 CCTAGATGCTGCTGCTTACCAAA No data
Right 977331945 4:95647419-95647441 CCAAAGAAACATGTCGTAGTAGG No data
977331943_977331946 -4 Left 977331943 4:95647401-95647423 CCTAGATGCTGCTGCTTACCAAA No data
Right 977331946 4:95647420-95647442 CAAAGAAACATGTCGTAGTAGGG No data
977331943_977331948 6 Left 977331943 4:95647401-95647423 CCTAGATGCTGCTGCTTACCAAA No data
Right 977331948 4:95647430-95647452 TGTCGTAGTAGGGGAACTCTTGG No data
977331943_977331949 7 Left 977331943 4:95647401-95647423 CCTAGATGCTGCTGCTTACCAAA No data
Right 977331949 4:95647431-95647453 GTCGTAGTAGGGGAACTCTTGGG No data
977331943_977331947 -3 Left 977331943 4:95647401-95647423 CCTAGATGCTGCTGCTTACCAAA No data
Right 977331947 4:95647421-95647443 AAAGAAACATGTCGTAGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977331943 Original CRISPR TTTGGTAAGCAGCAGCATCT AGG (reversed) Intergenic
No off target data available for this crispr