ID: 977332663

View in Genome Browser
Species Human (GRCh38)
Location 4:95657267-95657289
Sequence CAGTATTAGATCATCAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977332663_977332668 12 Left 977332663 4:95657267-95657289 CCTGCCTTGATGATCTAATACTG No data
Right 977332668 4:95657302-95657324 AGTCCCCCATTATTATTGTGTGG 0: 13
1: 3673
2: 5631
3: 2814
4: 1629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977332663 Original CRISPR CAGTATTAGATCATCAAGGC AGG (reversed) Intergenic
No off target data available for this crispr