ID: 977337993

View in Genome Browser
Species Human (GRCh38)
Location 4:95721960-95721982
Sequence CCCCTACCCCAGAACAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977337993_977337997 7 Left 977337993 4:95721960-95721982 CCATGTTTGTTCTGGGGTAGGGG No data
Right 977337997 4:95721990-95722012 CACCACCCTGGTTAGCTGAAAGG No data
977337993_977338000 9 Left 977337993 4:95721960-95721982 CCATGTTTGTTCTGGGGTAGGGG No data
Right 977338000 4:95721992-95722014 CCACCCTGGTTAGCTGAAAGGGG No data
977337993_977338003 18 Left 977337993 4:95721960-95721982 CCATGTTTGTTCTGGGGTAGGGG No data
Right 977338003 4:95722001-95722023 TTAGCTGAAAGGGGAAAGTATGG No data
977337993_977337998 8 Left 977337993 4:95721960-95721982 CCATGTTTGTTCTGGGGTAGGGG No data
Right 977337998 4:95721991-95722013 ACCACCCTGGTTAGCTGAAAGGG No data
977337993_977337996 -5 Left 977337993 4:95721960-95721982 CCATGTTTGTTCTGGGGTAGGGG No data
Right 977337996 4:95721978-95722000 AGGGGTTGTGGTCACCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977337993 Original CRISPR CCCCTACCCCAGAACAAACA TGG (reversed) Intergenic
No off target data available for this crispr