ID: 977338000

View in Genome Browser
Species Human (GRCh38)
Location 4:95721992-95722014
Sequence CCACCCTGGTTAGCTGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977337993_977338000 9 Left 977337993 4:95721960-95721982 CCATGTTTGTTCTGGGGTAGGGG No data
Right 977338000 4:95721992-95722014 CCACCCTGGTTAGCTGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977338000 Original CRISPR CCACCCTGGTTAGCTGAAAG GGG Intergenic
No off target data available for this crispr