ID: 977342088 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:95771734-95771756 |
| Sequence | TGACAATCAGCAGTGGTGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977342088_977342094 | 23 | Left | 977342088 | 4:95771734-95771756 | CCATCCACCACTGCTGATTGTCA | No data | ||
| Right | 977342094 | 4:95771780-95771802 | TCCACTCCTCCAGATCCAGCAGG | No data | ||||
| 977342088_977342096 | 24 | Left | 977342088 | 4:95771734-95771756 | CCATCCACCACTGCTGATTGTCA | No data | ||
| Right | 977342096 | 4:95771781-95771803 | CCACTCCTCCAGATCCAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977342088 | Original CRISPR | TGACAATCAGCAGTGGTGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||