ID: 977342088

View in Genome Browser
Species Human (GRCh38)
Location 4:95771734-95771756
Sequence TGACAATCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977342088_977342094 23 Left 977342088 4:95771734-95771756 CCATCCACCACTGCTGATTGTCA No data
Right 977342094 4:95771780-95771802 TCCACTCCTCCAGATCCAGCAGG No data
977342088_977342096 24 Left 977342088 4:95771734-95771756 CCATCCACCACTGCTGATTGTCA No data
Right 977342096 4:95771781-95771803 CCACTCCTCCAGATCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977342088 Original CRISPR TGACAATCAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr