ID: 977343403

View in Genome Browser
Species Human (GRCh38)
Location 4:95788889-95788911
Sequence GCTGTGAAGGCCATTATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977343403_977343408 13 Left 977343403 4:95788889-95788911 CCAATAATAATGGCCTTCACAGC No data
Right 977343408 4:95788925-95788947 CCACTCTGGGTGAGTGAGTGAGG No data
977343403_977343406 0 Left 977343403 4:95788889-95788911 CCAATAATAATGGCCTTCACAGC No data
Right 977343406 4:95788912-95788934 AGTATTGACAATTCCACTCTGGG No data
977343403_977343405 -1 Left 977343403 4:95788889-95788911 CCAATAATAATGGCCTTCACAGC No data
Right 977343405 4:95788911-95788933 CAGTATTGACAATTCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977343403 Original CRISPR GCTGTGAAGGCCATTATTAT TGG (reversed) Intergenic
No off target data available for this crispr