ID: 977347520

View in Genome Browser
Species Human (GRCh38)
Location 4:95836078-95836100
Sequence AATAACATGGTACAGTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977347514_977347520 25 Left 977347514 4:95836030-95836052 CCAAAAGTCATTAGAAGGGTTGT No data
Right 977347520 4:95836078-95836100 AATAACATGGTACAGTTAAGAGG No data
977347513_977347520 28 Left 977347513 4:95836027-95836049 CCACCAAAAGTCATTAGAAGGGT No data
Right 977347520 4:95836078-95836100 AATAACATGGTACAGTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977347520 Original CRISPR AATAACATGGTACAGTTAAG AGG Intergenic
No off target data available for this crispr