ID: 977349624

View in Genome Browser
Species Human (GRCh38)
Location 4:95865306-95865328
Sequence TATTCTCTTTATAAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977349620_977349624 11 Left 977349620 4:95865272-95865294 CCATTAAGAACAATGTCACCTGT No data
Right 977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG No data
977349618_977349624 23 Left 977349618 4:95865260-95865282 CCCAGTTTTTCTCCATTAAGAAC No data
Right 977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG No data
977349621_977349624 -7 Left 977349621 4:95865290-95865312 CCTGTGCAGTTTCATGTATTCTC No data
Right 977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG No data
977349619_977349624 22 Left 977349619 4:95865261-95865283 CCAGTTTTTCTCCATTAAGAACA No data
Right 977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977349624 Original CRISPR TATTCTCTTTATAAAGTGGA GGG Intergenic
No off target data available for this crispr