ID: 977352470

View in Genome Browser
Species Human (GRCh38)
Location 4:95905880-95905902
Sequence CATACTGTCCCCTTAATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977352465_977352470 20 Left 977352465 4:95905837-95905859 CCTGCAGTATCATTACATCTTCA No data
Right 977352470 4:95905880-95905902 CATACTGTCCCCTTAATAGGAGG No data
977352464_977352470 21 Left 977352464 4:95905836-95905858 CCCTGCAGTATCATTACATCTTC No data
Right 977352470 4:95905880-95905902 CATACTGTCCCCTTAATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977352470 Original CRISPR CATACTGTCCCCTTAATAGG AGG Intergenic
No off target data available for this crispr