ID: 977359125

View in Genome Browser
Species Human (GRCh38)
Location 4:95981316-95981338
Sequence ATGGATGACCAGCTGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977359121_977359125 25 Left 977359121 4:95981268-95981290 CCTCTCTGCTGAGAGCTGCAGAG 0: 59
1: 134
2: 230
3: 509
4: 917
Right 977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977359125 Original CRISPR ATGGATGACCAGCTGCAGAG AGG Intergenic
No off target data available for this crispr