ID: 977366751

View in Genome Browser
Species Human (GRCh38)
Location 4:96079268-96079290
Sequence GAACAGCCTGGAGGCCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977366747_977366751 -10 Left 977366747 4:96079255-96079277 CCCTGAAGCAGGGGAACAGCCTG No data
Right 977366751 4:96079268-96079290 GAACAGCCTGGAGGCCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977366751 Original CRISPR GAACAGCCTGGAGGCCAGTG TGG Intergenic
No off target data available for this crispr