ID: 977366754

View in Genome Browser
Species Human (GRCh38)
Location 4:96079293-96079315
Sequence AGAGTGCAATAAAGATGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977366752_977366754 -4 Left 977366752 4:96079274-96079296 CCTGGAGGCCAGTGTGGTTAGAG No data
Right 977366754 4:96079293-96079315 AGAGTGCAATAAAGATGAGAAGG No data
977366747_977366754 15 Left 977366747 4:96079255-96079277 CCCTGAAGCAGGGGAACAGCCTG No data
Right 977366754 4:96079293-96079315 AGAGTGCAATAAAGATGAGAAGG No data
977366748_977366754 14 Left 977366748 4:96079256-96079278 CCTGAAGCAGGGGAACAGCCTGG No data
Right 977366754 4:96079293-96079315 AGAGTGCAATAAAGATGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977366754 Original CRISPR AGAGTGCAATAAAGATGAGA AGG Intergenic
No off target data available for this crispr