ID: 977369335

View in Genome Browser
Species Human (GRCh38)
Location 4:96115316-96115338
Sequence GCTGTTCACCTGACAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977369335_977369342 20 Left 977369335 4:96115316-96115338 CCATTCACTGTCAGGTGAACAGC No data
Right 977369342 4:96115359-96115381 TAATTCAGTCATCTCCTGCTGGG No data
977369335_977369341 19 Left 977369335 4:96115316-96115338 CCATTCACTGTCAGGTGAACAGC No data
Right 977369341 4:96115358-96115380 ATAATTCAGTCATCTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977369335 Original CRISPR GCTGTTCACCTGACAGTGAA TGG (reversed) Intergenic
No off target data available for this crispr