ID: 977375065

View in Genome Browser
Species Human (GRCh38)
Location 4:96192092-96192114
Sequence TTATTTCACCAATTCTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977375063_977375065 -10 Left 977375063 4:96192079-96192101 CCACTGTCATGCCTTATTTCACC No data
Right 977375065 4:96192092-96192114 TTATTTCACCAATTCTCTCTTGG No data
977375062_977375065 -7 Left 977375062 4:96192076-96192098 CCACCACTGTCATGCCTTATTTC No data
Right 977375065 4:96192092-96192114 TTATTTCACCAATTCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977375065 Original CRISPR TTATTTCACCAATTCTCTCT TGG Intergenic
No off target data available for this crispr