ID: 977376070

View in Genome Browser
Species Human (GRCh38)
Location 4:96205614-96205636
Sequence GTGAACAGTAGGGGACCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977376070_977376076 -8 Left 977376070 4:96205614-96205636 CCCATAGGTCCCCTACTGTTCAC No data
Right 977376076 4:96205629-96205651 CTGTTCACCTCCACGTGGACAGG No data
977376070_977376081 10 Left 977376070 4:96205614-96205636 CCCATAGGTCCCCTACTGTTCAC No data
Right 977376081 4:96205647-96205669 ACAGGGGATGATCCTCCAAGTGG No data
977376070_977376077 -7 Left 977376070 4:96205614-96205636 CCCATAGGTCCCCTACTGTTCAC No data
Right 977376077 4:96205630-96205652 TGTTCACCTCCACGTGGACAGGG No data
977376070_977376082 11 Left 977376070 4:96205614-96205636 CCCATAGGTCCCCTACTGTTCAC No data
Right 977376082 4:96205648-96205670 CAGGGGATGATCCTCCAAGTGGG No data
977376070_977376078 -6 Left 977376070 4:96205614-96205636 CCCATAGGTCCCCTACTGTTCAC No data
Right 977376078 4:96205631-96205653 GTTCACCTCCACGTGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977376070 Original CRISPR GTGAACAGTAGGGGACCTAT GGG (reversed) Intergenic
No off target data available for this crispr