ID: 977378804

View in Genome Browser
Species Human (GRCh38)
Location 4:96243263-96243285
Sequence AATTTGCTATGAGAAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977378800_977378804 15 Left 977378800 4:96243225-96243247 CCAATATTTAGAAGTTGGAAGAC No data
Right 977378804 4:96243263-96243285 AATTTGCTATGAGAAAAATCTGG No data
977378797_977378804 26 Left 977378797 4:96243214-96243236 CCCAGAGTTAACCAATATTTAGA No data
Right 977378804 4:96243263-96243285 AATTTGCTATGAGAAAAATCTGG No data
977378798_977378804 25 Left 977378798 4:96243215-96243237 CCAGAGTTAACCAATATTTAGAA No data
Right 977378804 4:96243263-96243285 AATTTGCTATGAGAAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977378804 Original CRISPR AATTTGCTATGAGAAAAATC TGG Intergenic