ID: 977390656

View in Genome Browser
Species Human (GRCh38)
Location 4:96405566-96405588
Sequence TTGCCCAGGGTCACATTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977390652_977390656 22 Left 977390652 4:96405521-96405543 CCTCATTTTACACATGATGTCAA No data
Right 977390656 4:96405566-96405588 TTGCCCAGGGTCACATTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977390656 Original CRISPR TTGCCCAGGGTCACATTGTT GGG Intergenic
No off target data available for this crispr