ID: 977392727

View in Genome Browser
Species Human (GRCh38)
Location 4:96432292-96432314
Sequence TTGGAATACCACCACCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977392722_977392727 24 Left 977392722 4:96432245-96432267 CCTGGAGGCAAATTTATTATGCA No data
Right 977392727 4:96432292-96432314 TTGGAATACCACCACCATATTGG No data
977392721_977392727 25 Left 977392721 4:96432244-96432266 CCCTGGAGGCAAATTTATTATGC No data
Right 977392727 4:96432292-96432314 TTGGAATACCACCACCATATTGG No data
977392720_977392727 28 Left 977392720 4:96432241-96432263 CCTCCCTGGAGGCAAATTTATTA No data
Right 977392727 4:96432292-96432314 TTGGAATACCACCACCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977392727 Original CRISPR TTGGAATACCACCACCATAT TGG Intergenic
No off target data available for this crispr