ID: 977395943

View in Genome Browser
Species Human (GRCh38)
Location 4:96470338-96470360
Sequence ACTTATTTCTAGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977395939_977395943 20 Left 977395939 4:96470295-96470317 CCACAGGTTTAGGAAATAAAGGG No data
Right 977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG No data
977395941_977395943 -7 Left 977395941 4:96470322-96470344 CCATTTTCTAATGCTCACTTATT No data
Right 977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977395943 Original CRISPR ACTTATTTCTAGAAAGTGGA AGG Intergenic
No off target data available for this crispr