ID: 977401130

View in Genome Browser
Species Human (GRCh38)
Location 4:96534047-96534069
Sequence TTTTATATGGGCATTGTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977401130_977401135 30 Left 977401130 4:96534047-96534069 CCGTGAACAATGCCCATATAAAA No data
Right 977401135 4:96534100-96534122 GTTCTGACTGCTCCACTGGCTGG No data
977401130_977401134 26 Left 977401130 4:96534047-96534069 CCGTGAACAATGCCCATATAAAA No data
Right 977401134 4:96534096-96534118 ATGTGTTCTGACTGCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977401130 Original CRISPR TTTTATATGGGCATTGTTCA CGG (reversed) Intergenic
No off target data available for this crispr