ID: 977401130 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:96534047-96534069 |
| Sequence | TTTTATATGGGCATTGTTCA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 977401130_977401135 | 30 | Left | 977401130 | 4:96534047-96534069 | CCGTGAACAATGCCCATATAAAA | No data | ||
| Right | 977401135 | 4:96534100-96534122 | GTTCTGACTGCTCCACTGGCTGG | No data | ||||
| 977401130_977401134 | 26 | Left | 977401130 | 4:96534047-96534069 | CCGTGAACAATGCCCATATAAAA | No data | ||
| Right | 977401134 | 4:96534096-96534118 | ATGTGTTCTGACTGCTCCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 977401130 | Original CRISPR | TTTTATATGGGCATTGTTCA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||