ID: 977406686

View in Genome Browser
Species Human (GRCh38)
Location 4:96608553-96608575
Sequence CTTCTCGCTGTACCTTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977406684_977406686 3 Left 977406684 4:96608527-96608549 CCTGCTTTCTGGCGTACAGAGGC No data
Right 977406686 4:96608553-96608575 CTTCTCGCTGTACCTTCACATGG No data
977406680_977406686 26 Left 977406680 4:96608504-96608526 CCAGATTTGGTGTCTGGGGAGGG No data
Right 977406686 4:96608553-96608575 CTTCTCGCTGTACCTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977406686 Original CRISPR CTTCTCGCTGTACCTTCACA TGG Intergenic
No off target data available for this crispr