ID: 977408991

View in Genome Browser
Species Human (GRCh38)
Location 4:96637147-96637169
Sequence CAGAGCTAACACTACAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977408987_977408991 21 Left 977408987 4:96637103-96637125 CCCAGAGCGGTTGGAACATCCTA No data
Right 977408991 4:96637147-96637169 CAGAGCTAACACTACAAAGCAGG No data
977408988_977408991 20 Left 977408988 4:96637104-96637126 CCAGAGCGGTTGGAACATCCTAA No data
Right 977408991 4:96637147-96637169 CAGAGCTAACACTACAAAGCAGG No data
977408989_977408991 2 Left 977408989 4:96637122-96637144 CCTAAGTTGTCTCACAAGCAAGG No data
Right 977408991 4:96637147-96637169 CAGAGCTAACACTACAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977408991 Original CRISPR CAGAGCTAACACTACAAAGC AGG Intergenic
No off target data available for this crispr