ID: 977415454

View in Genome Browser
Species Human (GRCh38)
Location 4:96727195-96727217
Sequence AGGCCCATACACATTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977415454_977415460 14 Left 977415454 4:96727195-96727217 CCCTCCTCAATGTGTATGGGCCT No data
Right 977415460 4:96727232-96727254 AAGACATGAATAGAACAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977415454 Original CRISPR AGGCCCATACACATTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr