ID: 977418620

View in Genome Browser
Species Human (GRCh38)
Location 4:96766614-96766636
Sequence TAATCTTGGCCCAGTGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977418620_977418623 12 Left 977418620 4:96766614-96766636 CCTCAGGCACTGGGCCAAGATTA No data
Right 977418623 4:96766649-96766671 CAAGCGCAAACTATTAGAGGTGG No data
977418620_977418622 9 Left 977418620 4:96766614-96766636 CCTCAGGCACTGGGCCAAGATTA No data
Right 977418622 4:96766646-96766668 ACACAAGCGCAAACTATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977418620 Original CRISPR TAATCTTGGCCCAGTGCCTG AGG (reversed) Intergenic
No off target data available for this crispr