ID: 977420239

View in Genome Browser
Species Human (GRCh38)
Location 4:96790549-96790571
Sequence CCACATTAGTAGGTGTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977420239_977420245 6 Left 977420239 4:96790549-96790571 CCAGGGTACACCTACTAATGTGG No data
Right 977420245 4:96790578-96790600 AGAGAGCACAAAGGAGGAAAGGG No data
977420239_977420247 12 Left 977420239 4:96790549-96790571 CCAGGGTACACCTACTAATGTGG No data
Right 977420247 4:96790584-96790606 CACAAAGGAGGAAAGGGGTCAGG No data
977420239_977420246 7 Left 977420239 4:96790549-96790571 CCAGGGTACACCTACTAATGTGG No data
Right 977420246 4:96790579-96790601 GAGAGCACAAAGGAGGAAAGGGG No data
977420239_977420242 -3 Left 977420239 4:96790549-96790571 CCAGGGTACACCTACTAATGTGG No data
Right 977420242 4:96790569-96790591 TGGAGAGAGAGAGAGCACAAAGG No data
977420239_977420243 0 Left 977420239 4:96790549-96790571 CCAGGGTACACCTACTAATGTGG No data
Right 977420243 4:96790572-96790594 AGAGAGAGAGAGCACAAAGGAGG No data
977420239_977420244 5 Left 977420239 4:96790549-96790571 CCAGGGTACACCTACTAATGTGG No data
Right 977420244 4:96790577-96790599 GAGAGAGCACAAAGGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977420239 Original CRISPR CCACATTAGTAGGTGTACCC TGG (reversed) Intergenic
No off target data available for this crispr