ID: 977426002

View in Genome Browser
Species Human (GRCh38)
Location 4:96867888-96867910
Sequence TCCAGGGCTTTTATGGCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977426002_977426008 10 Left 977426002 4:96867888-96867910 CCTAAGGCCATAAAAGCCCTGGA No data
Right 977426008 4:96867921-96867943 GGCAATATCATTCAGGACATAGG 0: 286
1: 9224
2: 11597
3: 4473
4: 2319
977426002_977426009 15 Left 977426002 4:96867888-96867910 CCTAAGGCCATAAAAGCCCTGGA No data
Right 977426009 4:96867926-96867948 TATCATTCAGGACATAGGTATGG No data
977426002_977426007 3 Left 977426002 4:96867888-96867910 CCTAAGGCCATAAAAGCCCTGGA No data
Right 977426007 4:96867914-96867936 AAATCTAGGCAATATCATTCAGG 0: 55
1: 1046
2: 10160
3: 11796
4: 4586
977426002_977426010 16 Left 977426002 4:96867888-96867910 CCTAAGGCCATAAAAGCCCTGGA No data
Right 977426010 4:96867927-96867949 ATCATTCAGGACATAGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977426002 Original CRISPR TCCAGGGCTTTTATGGCCTT AGG (reversed) Intergenic
No off target data available for this crispr