ID: 977426008

View in Genome Browser
Species Human (GRCh38)
Location 4:96867921-96867943
Sequence GGCAATATCATTCAGGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27899
Summary {0: 286, 1: 9224, 2: 11597, 3: 4473, 4: 2319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977426005_977426008 -6 Left 977426005 4:96867904-96867926 CCCTGGAAGAAAATCTAGGCAAT 0: 35
1: 1032
2: 9843
3: 10948
4: 3560
Right 977426008 4:96867921-96867943 GGCAATATCATTCAGGACATAGG 0: 286
1: 9224
2: 11597
3: 4473
4: 2319
977426003_977426008 3 Left 977426003 4:96867895-96867917 CCATAAAAGCCCTGGAAGAAAAT No data
Right 977426008 4:96867921-96867943 GGCAATATCATTCAGGACATAGG 0: 286
1: 9224
2: 11597
3: 4473
4: 2319
977426002_977426008 10 Left 977426002 4:96867888-96867910 CCTAAGGCCATAAAAGCCCTGGA No data
Right 977426008 4:96867921-96867943 GGCAATATCATTCAGGACATAGG 0: 286
1: 9224
2: 11597
3: 4473
4: 2319
977426006_977426008 -7 Left 977426006 4:96867905-96867927 CCTGGAAGAAAATCTAGGCAATA 0: 37
1: 1103
2: 10334
3: 11709
4: 4533
Right 977426008 4:96867921-96867943 GGCAATATCATTCAGGACATAGG 0: 286
1: 9224
2: 11597
3: 4473
4: 2319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977426008 Original CRISPR GGCAATATCATTCAGGACAT AGG Intergenic
Too many off-targets to display for this crispr