ID: 977426009

View in Genome Browser
Species Human (GRCh38)
Location 4:96867926-96867948
Sequence TATCATTCAGGACATAGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977426003_977426009 8 Left 977426003 4:96867895-96867917 CCATAAAAGCCCTGGAAGAAAAT No data
Right 977426009 4:96867926-96867948 TATCATTCAGGACATAGGTATGG No data
977426006_977426009 -2 Left 977426006 4:96867905-96867927 CCTGGAAGAAAATCTAGGCAATA 0: 37
1: 1103
2: 10334
3: 11709
4: 4533
Right 977426009 4:96867926-96867948 TATCATTCAGGACATAGGTATGG No data
977426005_977426009 -1 Left 977426005 4:96867904-96867926 CCCTGGAAGAAAATCTAGGCAAT 0: 35
1: 1032
2: 9843
3: 10948
4: 3560
Right 977426009 4:96867926-96867948 TATCATTCAGGACATAGGTATGG No data
977426002_977426009 15 Left 977426002 4:96867888-96867910 CCTAAGGCCATAAAAGCCCTGGA No data
Right 977426009 4:96867926-96867948 TATCATTCAGGACATAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977426009 Original CRISPR TATCATTCAGGACATAGGTA TGG Intergenic
No off target data available for this crispr