ID: 977430763

View in Genome Browser
Species Human (GRCh38)
Location 4:96928182-96928204
Sequence AGGTATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977430763_977430768 16 Left 977430763 4:96928182-96928204 CCTGCCATCTTCTGCAGATACCT No data
Right 977430768 4:96928221-96928243 ACAGCTTTTGGCCTCTTACTGGG No data
977430763_977430767 15 Left 977430763 4:96928182-96928204 CCTGCCATCTTCTGCAGATACCT No data
Right 977430767 4:96928220-96928242 GACAGCTTTTGGCCTCTTACTGG No data
977430763_977430766 4 Left 977430763 4:96928182-96928204 CCTGCCATCTTCTGCAGATACCT No data
Right 977430766 4:96928209-96928231 TCTTTTTGAGAGACAGCTTTTGG No data
977430763_977430770 25 Left 977430763 4:96928182-96928204 CCTGCCATCTTCTGCAGATACCT No data
Right 977430770 4:96928230-96928252 GGCCTCTTACTGGGCTTTGGTGG No data
977430763_977430769 22 Left 977430763 4:96928182-96928204 CCTGCCATCTTCTGCAGATACCT No data
Right 977430769 4:96928227-96928249 TTTGGCCTCTTACTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977430763 Original CRISPR AGGTATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr