ID: 977430767

View in Genome Browser
Species Human (GRCh38)
Location 4:96928220-96928242
Sequence GACAGCTTTTGGCCTCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977430764_977430767 11 Left 977430764 4:96928186-96928208 CCATCTTCTGCAGATACCTACTC No data
Right 977430767 4:96928220-96928242 GACAGCTTTTGGCCTCTTACTGG No data
977430765_977430767 -5 Left 977430765 4:96928202-96928224 CCTACTCTCTTTTTGAGAGACAG No data
Right 977430767 4:96928220-96928242 GACAGCTTTTGGCCTCTTACTGG No data
977430762_977430767 16 Left 977430762 4:96928181-96928203 CCCTGCCATCTTCTGCAGATACC No data
Right 977430767 4:96928220-96928242 GACAGCTTTTGGCCTCTTACTGG No data
977430763_977430767 15 Left 977430763 4:96928182-96928204 CCTGCCATCTTCTGCAGATACCT No data
Right 977430767 4:96928220-96928242 GACAGCTTTTGGCCTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977430767 Original CRISPR GACAGCTTTTGGCCTCTTAC TGG Intergenic
No off target data available for this crispr