ID: 977437723

View in Genome Browser
Species Human (GRCh38)
Location 4:97020813-97020835
Sequence TCACATTAAGTGCCCTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977437723_977437724 -9 Left 977437723 4:97020813-97020835 CCTGTATAGGGCACTTAATGTGA No data
Right 977437724 4:97020827-97020849 TTAATGTGAATGAATCTTGTAGG No data
977437723_977437725 9 Left 977437723 4:97020813-97020835 CCTGTATAGGGCACTTAATGTGA No data
Right 977437725 4:97020845-97020867 GTAGGACTAGAAGTAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977437723 Original CRISPR TCACATTAAGTGCCCTATAC AGG (reversed) Intergenic
No off target data available for this crispr