ID: 977444140

View in Genome Browser
Species Human (GRCh38)
Location 4:97107497-97107519
Sequence GACAGAAACAAAAGGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444140_977444145 12 Left 977444140 4:97107497-97107519 CCAAGTTTCCTTTTGTTTCTGTC No data
Right 977444145 4:97107532-97107554 ACTAGTGTCCCAAGGAATCAAGG No data
977444140_977444148 18 Left 977444140 4:97107497-97107519 CCAAGTTTCCTTTTGTTTCTGTC No data
Right 977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG No data
977444140_977444146 13 Left 977444140 4:97107497-97107519 CCAAGTTTCCTTTTGTTTCTGTC No data
Right 977444146 4:97107533-97107555 CTAGTGTCCCAAGGAATCAAGGG No data
977444140_977444147 17 Left 977444140 4:97107497-97107519 CCAAGTTTCCTTTTGTTTCTGTC No data
Right 977444147 4:97107537-97107559 TGTCCCAAGGAATCAAGGGAAGG No data
977444140_977444144 4 Left 977444140 4:97107497-97107519 CCAAGTTTCCTTTTGTTTCTGTC No data
Right 977444144 4:97107524-97107546 AGAAAAACACTAGTGTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444140 Original CRISPR GACAGAAACAAAAGGAAACT TGG (reversed) Intergenic
No off target data available for this crispr