ID: 977444141

View in Genome Browser
Species Human (GRCh38)
Location 4:97107505-97107527
Sequence TTCTGAGGGACAGAAACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444141_977444152 27 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444152 4:97107555-97107577 GAAGGGAAGACAATGCATATGGG No data
977444141_977444151 26 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444151 4:97107554-97107576 GGAAGGGAAGACAATGCATATGG No data
977444141_977444153 28 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444153 4:97107556-97107578 AAGGGAAGACAATGCATATGGGG No data
977444141_977444145 4 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444145 4:97107532-97107554 ACTAGTGTCCCAAGGAATCAAGG No data
977444141_977444146 5 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444146 4:97107533-97107555 CTAGTGTCCCAAGGAATCAAGGG No data
977444141_977444144 -4 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444144 4:97107524-97107546 AGAAAAACACTAGTGTCCCAAGG No data
977444141_977444148 10 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG No data
977444141_977444147 9 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444147 4:97107537-97107559 TGTCCCAAGGAATCAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444141 Original CRISPR TTCTGAGGGACAGAAACAAA AGG (reversed) Intergenic
No off target data available for this crispr