ID: 977444142

View in Genome Browser
Species Human (GRCh38)
Location 4:97107519-97107541
Sequence GGACACTAGTGTTTTTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444142_977444151 12 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444151 4:97107554-97107576 GGAAGGGAAGACAATGCATATGG No data
977444142_977444152 13 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444152 4:97107555-97107577 GAAGGGAAGACAATGCATATGGG No data
977444142_977444145 -10 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444145 4:97107532-97107554 ACTAGTGTCCCAAGGAATCAAGG No data
977444142_977444146 -9 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444146 4:97107533-97107555 CTAGTGTCCCAAGGAATCAAGGG No data
977444142_977444154 22 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444154 4:97107564-97107586 ACAATGCATATGGGGTAGAGAGG No data
977444142_977444153 14 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444153 4:97107556-97107578 AAGGGAAGACAATGCATATGGGG No data
977444142_977444147 -5 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444147 4:97107537-97107559 TGTCCCAAGGAATCAAGGGAAGG No data
977444142_977444148 -4 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444142 Original CRISPR GGACACTAGTGTTTTTCTGA GGG (reversed) Intergenic