ID: 977444143

View in Genome Browser
Species Human (GRCh38)
Location 4:97107520-97107542
Sequence GGGACACTAGTGTTTTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444143_977444151 11 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444151 4:97107554-97107576 GGAAGGGAAGACAATGCATATGG No data
977444143_977444146 -10 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444146 4:97107533-97107555 CTAGTGTCCCAAGGAATCAAGGG No data
977444143_977444152 12 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444152 4:97107555-97107577 GAAGGGAAGACAATGCATATGGG No data
977444143_977444148 -5 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG No data
977444143_977444147 -6 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444147 4:97107537-97107559 TGTCCCAAGGAATCAAGGGAAGG No data
977444143_977444153 13 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444153 4:97107556-97107578 AAGGGAAGACAATGCATATGGGG No data
977444143_977444154 21 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444154 4:97107564-97107586 ACAATGCATATGGGGTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444143 Original CRISPR GGGACACTAGTGTTTTTCTG AGG (reversed) Intergenic
No off target data available for this crispr