ID: 977444144

View in Genome Browser
Species Human (GRCh38)
Location 4:97107524-97107546
Sequence AGAAAAACACTAGTGTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444141_977444144 -4 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444144 4:97107524-97107546 AGAAAAACACTAGTGTCCCAAGG No data
977444139_977444144 18 Left 977444139 4:97107483-97107505 CCGTATTAAAAGCACCAAGTTTC No data
Right 977444144 4:97107524-97107546 AGAAAAACACTAGTGTCCCAAGG No data
977444140_977444144 4 Left 977444140 4:97107497-97107519 CCAAGTTTCCTTTTGTTTCTGTC No data
Right 977444144 4:97107524-97107546 AGAAAAACACTAGTGTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444144 Original CRISPR AGAAAAACACTAGTGTCCCA AGG Intergenic