ID: 977444145

View in Genome Browser
Species Human (GRCh38)
Location 4:97107532-97107554
Sequence ACTAGTGTCCCAAGGAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444139_977444145 26 Left 977444139 4:97107483-97107505 CCGTATTAAAAGCACCAAGTTTC No data
Right 977444145 4:97107532-97107554 ACTAGTGTCCCAAGGAATCAAGG No data
977444140_977444145 12 Left 977444140 4:97107497-97107519 CCAAGTTTCCTTTTGTTTCTGTC No data
Right 977444145 4:97107532-97107554 ACTAGTGTCCCAAGGAATCAAGG No data
977444142_977444145 -10 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444145 4:97107532-97107554 ACTAGTGTCCCAAGGAATCAAGG No data
977444141_977444145 4 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444145 4:97107532-97107554 ACTAGTGTCCCAAGGAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444145 Original CRISPR ACTAGTGTCCCAAGGAATCA AGG Intergenic