ID: 977444146

View in Genome Browser
Species Human (GRCh38)
Location 4:97107533-97107555
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444143_977444146 -10 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444146 4:97107533-97107555 CTAGTGTCCCAAGGAATCAAGGG No data
977444139_977444146 27 Left 977444139 4:97107483-97107505 CCGTATTAAAAGCACCAAGTTTC No data
Right 977444146 4:97107533-97107555 CTAGTGTCCCAAGGAATCAAGGG No data
977444141_977444146 5 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444146 4:97107533-97107555 CTAGTGTCCCAAGGAATCAAGGG No data
977444140_977444146 13 Left 977444140 4:97107497-97107519 CCAAGTTTCCTTTTGTTTCTGTC No data
Right 977444146 4:97107533-97107555 CTAGTGTCCCAAGGAATCAAGGG No data
977444142_977444146 -9 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444146 4:97107533-97107555 CTAGTGTCCCAAGGAATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type