ID: 977444147

View in Genome Browser
Species Human (GRCh38)
Location 4:97107537-97107559
Sequence TGTCCCAAGGAATCAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444143_977444147 -6 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444147 4:97107537-97107559 TGTCCCAAGGAATCAAGGGAAGG No data
977444141_977444147 9 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444147 4:97107537-97107559 TGTCCCAAGGAATCAAGGGAAGG No data
977444140_977444147 17 Left 977444140 4:97107497-97107519 CCAAGTTTCCTTTTGTTTCTGTC No data
Right 977444147 4:97107537-97107559 TGTCCCAAGGAATCAAGGGAAGG No data
977444142_977444147 -5 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444147 4:97107537-97107559 TGTCCCAAGGAATCAAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444147 Original CRISPR TGTCCCAAGGAATCAAGGGA AGG Intergenic
No off target data available for this crispr