ID: 977444148

View in Genome Browser
Species Human (GRCh38)
Location 4:97107538-97107560
Sequence GTCCCAAGGAATCAAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444142_977444148 -4 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG No data
977444140_977444148 18 Left 977444140 4:97107497-97107519 CCAAGTTTCCTTTTGTTTCTGTC No data
Right 977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG No data
977444141_977444148 10 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG No data
977444143_977444148 -5 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444148 4:97107538-97107560 GTCCCAAGGAATCAAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444148 Original CRISPR GTCCCAAGGAATCAAGGGAA GGG Intergenic
No off target data available for this crispr