ID: 977444149

View in Genome Browser
Species Human (GRCh38)
Location 4:97107540-97107562
Sequence TTCCCTTCCCTTGATTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444149_977444151 -9 Left 977444149 4:97107540-97107562 CCCAAGGAATCAAGGGAAGGGAA No data
Right 977444151 4:97107554-97107576 GGAAGGGAAGACAATGCATATGG No data
977444149_977444155 12 Left 977444149 4:97107540-97107562 CCCAAGGAATCAAGGGAAGGGAA No data
Right 977444155 4:97107575-97107597 GGGGTAGAGAGGTCAGCCATAGG No data
977444149_977444152 -8 Left 977444149 4:97107540-97107562 CCCAAGGAATCAAGGGAAGGGAA No data
Right 977444152 4:97107555-97107577 GAAGGGAAGACAATGCATATGGG No data
977444149_977444154 1 Left 977444149 4:97107540-97107562 CCCAAGGAATCAAGGGAAGGGAA No data
Right 977444154 4:97107564-97107586 ACAATGCATATGGGGTAGAGAGG No data
977444149_977444153 -7 Left 977444149 4:97107540-97107562 CCCAAGGAATCAAGGGAAGGGAA No data
Right 977444153 4:97107556-97107578 AAGGGAAGACAATGCATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444149 Original CRISPR TTCCCTTCCCTTGATTCCTT GGG (reversed) Intergenic
No off target data available for this crispr