ID: 977444152

View in Genome Browser
Species Human (GRCh38)
Location 4:97107555-97107577
Sequence GAAGGGAAGACAATGCATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444142_977444152 13 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444152 4:97107555-97107577 GAAGGGAAGACAATGCATATGGG No data
977444143_977444152 12 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444152 4:97107555-97107577 GAAGGGAAGACAATGCATATGGG No data
977444150_977444152 -9 Left 977444150 4:97107541-97107563 CCAAGGAATCAAGGGAAGGGAAG No data
Right 977444152 4:97107555-97107577 GAAGGGAAGACAATGCATATGGG No data
977444141_977444152 27 Left 977444141 4:97107505-97107527 CCTTTTGTTTCTGTCCCTCAGAA No data
Right 977444152 4:97107555-97107577 GAAGGGAAGACAATGCATATGGG No data
977444149_977444152 -8 Left 977444149 4:97107540-97107562 CCCAAGGAATCAAGGGAAGGGAA No data
Right 977444152 4:97107555-97107577 GAAGGGAAGACAATGCATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444152 Original CRISPR GAAGGGAAGACAATGCATAT GGG Intergenic
No off target data available for this crispr