ID: 977444154

View in Genome Browser
Species Human (GRCh38)
Location 4:97107564-97107586
Sequence ACAATGCATATGGGGTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444143_977444154 21 Left 977444143 4:97107520-97107542 CCTCAGAAAAACACTAGTGTCCC No data
Right 977444154 4:97107564-97107586 ACAATGCATATGGGGTAGAGAGG No data
977444150_977444154 0 Left 977444150 4:97107541-97107563 CCAAGGAATCAAGGGAAGGGAAG No data
Right 977444154 4:97107564-97107586 ACAATGCATATGGGGTAGAGAGG No data
977444142_977444154 22 Left 977444142 4:97107519-97107541 CCCTCAGAAAAACACTAGTGTCC No data
Right 977444154 4:97107564-97107586 ACAATGCATATGGGGTAGAGAGG No data
977444149_977444154 1 Left 977444149 4:97107540-97107562 CCCAAGGAATCAAGGGAAGGGAA No data
Right 977444154 4:97107564-97107586 ACAATGCATATGGGGTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444154 Original CRISPR ACAATGCATATGGGGTAGAG AGG Intergenic
No off target data available for this crispr