ID: 977444267

View in Genome Browser
Species Human (GRCh38)
Location 4:97109565-97109587
Sequence TTGTAGAAGAATATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977444264_977444267 -9 Left 977444264 4:97109551-97109573 CCCAGATTATAAAATTGTAGAAG No data
Right 977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG No data
977444265_977444267 -10 Left 977444265 4:97109552-97109574 CCAGATTATAAAATTGTAGAAGA No data
Right 977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977444267 Original CRISPR TTGTAGAAGAATATGGAAGA AGG Intergenic
No off target data available for this crispr