ID: 977447529

View in Genome Browser
Species Human (GRCh38)
Location 4:97149624-97149646
Sequence CAGAAACAGAAACAGTAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977447529_977447531 8 Left 977447529 4:97149624-97149646 CCTCACTACTGTTTCTGTTTCTG No data
Right 977447531 4:97149655-97149677 TTTCAACTTCAACTAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977447529 Original CRISPR CAGAAACAGAAACAGTAGTG AGG (reversed) Intergenic
No off target data available for this crispr