ID: 977451706

View in Genome Browser
Species Human (GRCh38)
Location 4:97207131-97207153
Sequence CTTTGAATCAGGAGCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977451700_977451706 26 Left 977451700 4:97207082-97207104 CCCTCTGCTGAAAAAGCTTTTTG 0: 1
1: 0
2: 2
3: 30
4: 337
Right 977451706 4:97207131-97207153 CTTTGAATCAGGAGCTGCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 206
977451701_977451706 25 Left 977451701 4:97207083-97207105 CCTCTGCTGAAAAAGCTTTTTGT 0: 1
1: 1
2: 24
3: 66
4: 341
Right 977451706 4:97207131-97207153 CTTTGAATCAGGAGCTGCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977451706 Original CRISPR CTTTGAATCAGGAGCTGCCT GGG Intronic
900094703 1:935580-935602 CTTTGACTCGGGTGCTGCGTGGG + Intronic
900476133 1:2877215-2877237 CTTTGAGTCGGGAGCCTCCTTGG + Intergenic
900567636 1:3341430-3341452 CTTCCATTCAGGAGCTGCTTAGG - Intronic
900944096 1:5819978-5820000 CCTTGAATCTGGGGCTGCCTGGG - Intergenic
901105711 1:6754690-6754712 GTTTGAATCAGGTGCTTCGTTGG + Intergenic
902670101 1:17967296-17967318 CTGTGAATCAGGCACTGCATTGG + Intergenic
902763152 1:18597542-18597564 CTTGGAATCAGGAGCTGACCCGG - Intergenic
903634949 1:24806433-24806455 TTTGGAATCAGGACCTGCCATGG + Intronic
904576991 1:31511321-31511343 CTGAGACTCAGGAGCTTCCTAGG - Intergenic
905447906 1:38039237-38039259 CTTGGAAGGAGGGGCTGCCTGGG - Intergenic
905822809 1:41006952-41006974 CCTGGAATCAGAAGGTGCCTGGG + Intronic
909365286 1:74813470-74813492 CTCTGAATCAGTAGGTGTCTTGG + Intergenic
911623946 1:100099465-100099487 CTGAGAATCAAGAGATGCCTAGG + Intronic
918515188 1:185355880-185355902 CTTTGTTTCAGGAGCTGACCTGG - Intergenic
919539278 1:198828571-198828593 CTTGATGTCAGGAGCTGCCTGGG + Intergenic
919761063 1:201098653-201098675 CTTCGAACCAGGTGCAGCCTTGG + Intronic
919801848 1:201359100-201359122 TTTCCAAACAGGAGCTGCCTGGG + Exonic
919939953 1:202279248-202279270 CTTTGGATCAGAAGCTCCCTGGG + Intronic
921354196 1:214270279-214270301 CTTTGTGTCAGGCTCTGCCTGGG + Intergenic
924332633 1:242955220-242955242 CTCTGAATCAGGAGTTATCTGGG - Intergenic
1062936438 10:1394166-1394188 CTTGGAATCAGAAGCTGATTGGG - Intronic
1065654761 10:27937136-27937158 CTTCGCCTCAGGAGATGCCTAGG - Intronic
1066192287 10:33067130-33067152 CTTTGTTTTAGGAGCTGTCTTGG + Intergenic
1066703087 10:38150339-38150361 CTTTGAAAGAGGAGATGCCAAGG + Intergenic
1066987771 10:42483349-42483371 CTTTGAAAGAGGAGATGCCAAGG - Intergenic
1070224753 10:74491288-74491310 CTTTGAGTCAGGATCTCACTAGG + Intronic
1070813483 10:79309961-79309983 CTTTGAAGGAGGATCTGCTTGGG + Intronic
1073030600 10:100522672-100522694 CTATGATTCAGAAGCTGCTTTGG + Intronic
1074136635 10:110633131-110633153 CTTGGAATGAGGCACTGCCTGGG - Intergenic
1075006610 10:118835210-118835232 CTTTGGATCTGGAACTGCATGGG - Intergenic
1075812712 10:125237225-125237247 TTTGAATTCAGGAGCTGCCTAGG + Intergenic
1076663121 10:132068633-132068655 CTTAGCCCCAGGAGCTGCCTGGG + Intergenic
1078906951 11:15696428-15696450 CTTAGACTCAGGACATGCCTTGG - Intergenic
1079095598 11:17508063-17508085 CTTTGATTGAGTACCTGCCTGGG - Intronic
1082197784 11:49325106-49325128 TTTTAAGTCAGGAGCTGACTGGG + Intergenic
1082810227 11:57475038-57475060 CTTTAAAAGAGGAGCTCCCTGGG - Intronic
1083178340 11:60967359-60967381 CTGTGAAACATGGGCTGCCTGGG + Intergenic
1084170050 11:67396704-67396726 CTGGGAGGCAGGAGCTGCCTGGG + Intronic
1086115674 11:83247025-83247047 TTTTAAATCAGGAGCTTTCTTGG + Intronic
1087751606 11:102013157-102013179 CTTAGAATAAGGAGCTGCAGAGG + Intergenic
1087956321 11:104291984-104292006 CTTTGAATCAGGAAATGTTTGGG - Intergenic
1089422011 11:118339062-118339084 CTTTCACTCAGCAGGTGCCTGGG - Exonic
1093779388 12:23117356-23117378 CTTTGAATCCAGAGCTACCCTGG + Intergenic
1097174011 12:57132439-57132461 CCTTGAGTCAGGCACTGCCTAGG + Intronic
1100163532 12:91890434-91890456 CAATGAATCAGGGGATGCCTTGG - Intergenic
1101816870 12:108152205-108152227 CTCTGAAACTGGAGCTGGCTAGG - Intronic
1103654157 12:122457069-122457091 TTTTGAGTCAGGATCTCCCTAGG - Intergenic
1104123794 12:125824250-125824272 GTTTGAAAGAGGAGCTTCCTCGG - Intergenic
1106015009 13:25860683-25860705 CTTTCAAACCGGAGCTGCCTTGG + Intronic
1107828051 13:44348207-44348229 CTTTGAAGCAATATCTGCCTCGG - Intergenic
1107904366 13:45048571-45048593 CTTTTATTCAGGATTTGCCTGGG - Intergenic
1110636815 13:77776114-77776136 CCTTGTCTCAGGATCTGCCTTGG - Intergenic
1112304839 13:98264453-98264475 CAGTCACTCAGGAGCTGCCTTGG + Intronic
1113028070 13:105963087-105963109 CTTTGAATCAGGACCAGACCTGG - Intergenic
1117441128 14:55760381-55760403 CTTTAAAACAGCAGCTGGCTGGG + Intergenic
1117685174 14:58245357-58245379 CTGTGAATCAGCAGCACCCTAGG - Intronic
1119440613 14:74625980-74626002 TTTTGAACCAGTAGCTACCTAGG - Intergenic
1121386688 14:93533724-93533746 CTTTGAATCTGGGCCGGCCTTGG - Intronic
1123038394 14:105480545-105480567 CTGAGAACCCGGAGCTGCCTGGG + Intergenic
1124054045 15:26225287-26225309 CTATGAGTTAGGTGCTGCCTTGG + Intergenic
1124341867 15:28894932-28894954 CAATGACGCAGGAGCTGCCTTGG - Intronic
1125509463 15:40285014-40285036 CTTTGGAGTAGGAGATGCCTGGG + Intronic
1125883247 15:43210806-43210828 CTCAGGAACAGGAGCTGCCTCGG - Intronic
1127208438 15:56745099-56745121 CTTTGGACCAGAAGGTGCCTGGG - Intronic
1127776574 15:62268684-62268706 CCATGAATCAGCAGCTGCCAGGG + Intergenic
1128838508 15:70830819-70830841 GTTATCATCAGGAGCTGCCTTGG - Exonic
1129036982 15:72656246-72656268 CCATGAATCAGCAGCTGCCGGGG - Intronic
1129212904 15:74080979-74081001 CCATGAATCAGCAGCTGCCGGGG + Intronic
1129397497 15:75260107-75260129 CCATGAATCAGCAGCTGCCGGGG - Intronic
1129401107 15:75284384-75284406 CCATGAATCAGCAGCTGCCGGGG - Intronic
1129474708 15:75777092-75777114 CCATGAATCAGCAGCTGCCAGGG - Intergenic
1129692361 15:77721085-77721107 CTTTGAGTCAGGAGTGGACTGGG - Intronic
1129838478 15:78728692-78728714 CCATGAATCAGCAGCTGCCAGGG - Intergenic
1130624340 15:85498111-85498133 GTTTGGAGGAGGAGCTGCCTTGG + Intronic
1130960932 15:88658231-88658253 CTAAAAATCAAGAGCTGCCTTGG + Intergenic
1133647853 16:7781103-7781125 CTTTAAATGAGATGCTGCCTAGG - Intergenic
1134691911 16:16196664-16196686 CTCTGTATCGGGAACTGCCTAGG - Intronic
1135587294 16:23680667-23680689 CTTTGAAACAGGAACTGACAGGG - Intronic
1137815579 16:51394888-51394910 CAAGGAATAAGGAGCTGCCTGGG - Intergenic
1142713083 17:1733839-1733861 CCCTGAAGCAGGAGCTGCCGCGG + Exonic
1142736984 17:1907409-1907431 ATTTGCTTCAGGACCTGCCTAGG + Intergenic
1144324227 17:14162417-14162439 CTTTGGTTCAGGAGGTCCCTGGG - Intronic
1145814839 17:27788084-27788106 CTCTGGATCTGGAGCTGGCTGGG - Intronic
1146709074 17:35025115-35025137 CTGTGTATCAGGAATTGCCTGGG - Intronic
1149310386 17:55387268-55387290 CTTTAAATAATGAGCTGCTTTGG + Intergenic
1149775203 17:59351798-59351820 CTTTGCATGAGGAGCTTCCTTGG + Intronic
1150203297 17:63379228-63379250 ATTTGGATAAGGAACTGCCTAGG + Intronic
1150785405 17:68158974-68158996 CTTGGCATCAGGAGCTGTTTAGG + Intergenic
1151188074 17:72378644-72378666 CCCTGAAGCAGCAGCTGCCTGGG + Intergenic
1152471311 17:80491376-80491398 CTTTGAATGAGCAGATACCTCGG + Intergenic
1154031723 18:10759005-10759027 CTTTGGATCACCAGCTGCCATGG + Intronic
1155896687 18:31337948-31337970 TTTAGAATTAGGAGCAGCCTGGG + Intronic
1157784752 18:50471581-50471603 CTTTGAACCAGGAACTGCAGTGG - Intergenic
1159959323 18:74543186-74543208 CTATGAATCAGGAGCAGACAGGG + Intronic
1161035683 19:2083202-2083224 CTTTGAATCAGGGGCTTCCCAGG - Intronic
1161310531 19:3591557-3591579 CTCTGAATCCTGAGCTGACTGGG - Exonic
1163129235 19:15262050-15262072 CTGTGGATCAGGGGCTGCCTTGG - Intronic
1166123942 19:40702644-40702666 CCTTGCAGCAGGAGCTGGCTTGG - Exonic
1166921644 19:46232612-46232634 CTTTGAGTCAGAATCTGCCCAGG - Intergenic
1168450277 19:56461246-56461268 GATTAAATCAGGAGCTGTCTGGG - Intronic
925053335 2:834324-834346 AACTGATTCAGGAGCTGCCTCGG + Intergenic
926240019 2:11078264-11078286 CAGTGGAGCAGGAGCTGCCTGGG + Intergenic
926910250 2:17846250-17846272 TTTTGCATCAGGTGCTGTCTTGG - Intergenic
928419078 2:31123514-31123536 CTTTGAAACAGCAGATGCTTTGG + Intronic
929422579 2:41808428-41808450 CTTTCAATCAAGAGATGACTGGG + Intergenic
929955642 2:46456558-46456580 CTCTGGATGAGGAGCTGGCTTGG - Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
932921239 2:75917185-75917207 CTCAGAATTAGGAGTTGCCTAGG + Intergenic
932985132 2:76716801-76716823 GTTTGTATAATGAGCTGCCTTGG - Intergenic
933861715 2:86475961-86475983 CTAGGAATCCAGAGCTGCCTGGG + Intronic
934606326 2:95698336-95698358 CTTTGAAGCAGGATCTGCTCAGG + Intergenic
937538455 2:122920094-122920116 CTTTGAATGATAAGCTGCTTTGG - Intergenic
940471375 2:154104622-154104644 CTTTGTCTCAGGAGGTGCTTTGG + Intronic
943701160 2:190989359-190989381 ATTTAAATCAGCAGCTCCCTTGG - Intronic
945178558 2:207068110-207068132 CTTTTAAGCAGAAGCTCCCTGGG - Intergenic
945203261 2:207306182-207306204 CTTACAATCAGGGTCTGCCTCGG + Intergenic
945283463 2:208059513-208059535 CTGGGAATAAAGAGCTGCCTAGG + Intergenic
947041188 2:225922500-225922522 CTCTGAATCAGTGGCTGCCCAGG + Intergenic
948177074 2:235952472-235952494 ATTTGCATCATGAGCTGCCTGGG - Intronic
948411785 2:237768913-237768935 CTTTGAGTCAGGGTCTGACTCGG + Intronic
948521336 2:238540374-238540396 CTTTGGACCAGGAGGTGTCTTGG - Intergenic
948522435 2:238548711-238548733 CATTGAACCAGGAGGTGTCTTGG - Intergenic
1169149276 20:3276579-3276601 CATTGAATCAGGGGCAGCCCTGG - Intronic
1170805169 20:19623377-19623399 CTCTGAAACAGGAGCTGCAAAGG + Intronic
1173158006 20:40631303-40631325 CTTTGACTCAGCAACTGCCCAGG - Intergenic
1173665728 20:44761727-44761749 CTTTGAATCAGGGTCTGCTCTGG + Intronic
1173962937 20:47089115-47089137 CTTTGCCTCTGGTGCTGCCTTGG + Intronic
1176910451 21:14558926-14558948 CCTGGAATCAGGAGCTGAGTCGG - Intronic
1181449836 22:23012352-23012374 CTTTGGCTCTAGAGCTGCCTGGG + Intergenic
1181603306 22:23965058-23965080 GTCTGAATCAGGATCAGCCTTGG + Intergenic
1181605208 22:23976249-23976271 GTCTGAATCAGGATCAGCCTTGG - Intronic
1181712371 22:24698556-24698578 CTTCGATTCACCAGCTGCCTAGG - Intergenic
1184601120 22:45543937-45543959 GTTTTAATCAGATGCTGCCTAGG + Intronic
1184950608 22:47840029-47840051 ATTTGAATCATGTGCTTCCTGGG - Intergenic
950761091 3:15227475-15227497 CTTTGAATCTTTAGCTTCCTAGG + Intronic
955579232 3:60401085-60401107 CTTTAAATCAGGTGCTACCAGGG - Intronic
955712661 3:61796490-61796512 CCTTGAGACAGCAGCTGCCTAGG + Intronic
956167525 3:66407822-66407844 GCCTGAATCAGGAGCTGCCTTGG - Intronic
956666391 3:71645845-71645867 TTTTGAATGTGGAGCTACCTGGG + Intergenic
959536952 3:107497445-107497467 CTTTGTCTCAGGTTCTGCCTTGG - Intergenic
960450815 3:117805686-117805708 CTTTCAATCAGGAGTTAGCTGGG - Intergenic
962068543 3:132009516-132009538 CTTTGAACCTGGAGCTTCCTGGG - Intronic
962953141 3:140239544-140239566 CTTTGAATACGGAGCTGATTTGG - Intronic
963250644 3:143100046-143100068 CTTTGAATCAGGAGGAACCATGG + Intergenic
963606083 3:147412707-147412729 CTTTGAGGCAGGAGCTCTCTTGG + Intronic
963799241 3:149659671-149659693 GTTAAAATCTGGAGCTGCCTTGG + Intronic
964674892 3:159266998-159267020 CATGGAATGAGGCGCTGCCTGGG + Intronic
966392156 3:179464248-179464270 CAGGGAATCAAGAGCTGCCTAGG + Intergenic
966821396 3:183927616-183927638 ATTGGAATCAGGGACTGCCTTGG - Intronic
967134413 3:186501461-186501483 CTTGGAATCTGGAGCTTGCTGGG + Intergenic
969628847 4:8323508-8323530 CTTTGAATCAGGAACAGCTGAGG + Intergenic
970208551 4:13682147-13682169 CCTTGAATCTGCAGCTTCCTGGG - Intergenic
972353529 4:38259709-38259731 CTTAGAATGCGGAGCTGTCTGGG + Intergenic
972419460 4:38872943-38872965 CTCTGAATCAGGACTAGCCTAGG - Intronic
974762515 4:66296008-66296030 CCTTGAAGCAGGAGCTGCAGAGG + Intergenic
977451706 4:97207131-97207153 CTTTGAATCAGGAGCTGCCTGGG + Intronic
981472722 4:145154935-145154957 ATTTGAATAAGCAGCTGCCCTGG - Intronic
981886590 4:149681699-149681721 CTTTGAATCAATAGCCCCCTAGG + Intergenic
982957937 4:161794148-161794170 CTTTGAAACAAGTGATGCCTGGG + Intronic
983557651 4:169072651-169072673 CTTTGACTCAGGAGCTGGAGAGG + Intergenic
987273938 5:16342208-16342230 CTTTGAATCAGGACTTGATTTGG - Intergenic
988483674 5:31650410-31650432 CTGAGAAGCAGGAACTGCCTGGG + Intronic
988706766 5:33734280-33734302 CTTTGGAACAAAAGCTGCCTAGG + Intronic
991653493 5:68880490-68880512 TTTGGAAACAGGAGCTTCCTTGG - Intergenic
995683699 5:114747799-114747821 CAATGAACCAGGAGCTTCCTTGG + Intergenic
996755028 5:126926636-126926658 TTTTGAGTAAGGAGCTGTCTGGG + Intronic
997450456 5:133978497-133978519 CTGTGAATCAGGCAGTGCCTGGG - Intronic
998005344 5:138653249-138653271 CTTGGAAACAGGAGCAGCCATGG + Intronic
1001030331 5:168257907-168257929 CTTTCAATCAGGAGCTGGCCGGG - Intronic
1001763074 5:174223525-174223547 CCTTGATTCAGGAGATGCCCCGG + Intronic
1004815044 6:19303679-19303701 CTAGGAATCAGCAGTTGCCTTGG - Intergenic
1007490094 6:42214080-42214102 CTTGGTATAAGGAGCTACCTTGG - Intronic
1007491494 6:42226465-42226487 TTGTGAGTCAGGAACTGCCTGGG - Exonic
1007923767 6:45634511-45634533 CTTTAAAGCAGGATCTTCCTGGG + Intronic
1014089092 6:117382952-117382974 CTTTGAATCAGGTGGTGACTAGG - Intronic
1014921699 6:127221224-127221246 CTTTTAATCAAGAACTTCCTCGG - Intergenic
1015644404 6:135370206-135370228 TTTCAAATCAGGAGCTGACTTGG + Intronic
1019188383 6:170235168-170235190 CTTTGAATAAAAACCTGCCTCGG - Intergenic
1019789040 7:2998466-2998488 CTTGAACTCAGGAGTTGCCTGGG + Intronic
1022255277 7:28650214-28650236 CTTTGTGTCAGGTGCTGACTTGG + Intronic
1022885875 7:34643243-34643265 CTTTGAAACAGAAGCTGGGTTGG - Intergenic
1024908596 7:54419366-54419388 CTTTGACTCCGGGGCTGCCTAGG - Intergenic
1030186236 7:106764864-106764886 CTTTGCATTACGAACTGCCTTGG - Intergenic
1032011265 7:128349735-128349757 CTTTGCTACAGGAGCTGGCTGGG + Intergenic
1033370638 7:140704300-140704322 CCTTCAGTAAGGAGCTGCCTGGG + Intronic
1034284227 7:149873875-149873897 CTGTCACTCAGGACCTGCCTAGG - Exonic
1034873620 7:154705676-154705698 CTGTGACTCAGGGGCTGTCTGGG - Intronic
1035214979 7:157358909-157358931 CTTTGAAAATGGAGCTGACTTGG + Intronic
1036406608 8:8460857-8460879 CATTAAATTAGGAGATGCCTAGG - Intergenic
1037529996 8:19763792-19763814 CTTTGGATCAGGACTTGCCTAGG - Intergenic
1038520513 8:28228266-28228288 CTTTATATCAGGAGATACCTGGG + Intergenic
1040690909 8:49937285-49937307 GAGTGGATCAGGAGCTGCCTGGG + Intronic
1042756593 8:72220817-72220839 CTTTGAAATAAGAGCTGCTTTGG + Intergenic
1048011963 8:130464938-130464960 GTTTCAGTCAGGACCTGCCTGGG + Intergenic
1048469846 8:134696269-134696291 CTGGGACTCAGGGGCTGCCTTGG - Intronic
1048505488 8:135017106-135017128 CTTAGAATCTGGAGCAGCCGTGG + Intergenic
1049819153 8:144623972-144623994 CTTGGCATCAGCAGCAGCCTTGG + Intergenic
1050259616 9:3827824-3827846 CTTTGCATCAGGAGCAGCAAGGG + Exonic
1052776529 9:32738686-32738708 TTCTGACTCAGGACCTGCCTAGG - Intergenic
1056445886 9:86666060-86666082 CCTTGAATCAGGACTGGCCTTGG + Intergenic
1058010540 9:99971941-99971963 CTTGAACTCAGGAGCAGCCTTGG + Intergenic
1060453075 9:123762071-123762093 CTTTGAACCAGAAGTTGGCTTGG - Intronic
1060495470 9:124115226-124115248 CTTGGAATCTGGAGCTCCCAAGG - Intergenic
1060727611 9:126016618-126016640 CCTTGCCTCAGGTGCTGCCTGGG + Intergenic
1061316078 9:129796579-129796601 TTCTGAATCAGCAGCTGCCAGGG - Intergenic
1061328056 9:129875931-129875953 CCTTGAAGCAGGACCTCCCTTGG + Intronic
1061852748 9:133425456-133425478 CTGGGAGTCAGCAGCTGCCTGGG + Intronic
1062426630 9:136509058-136509080 CGTTGAAGCAGGAGCTGCAAGGG + Exonic
1189309644 X:40010337-40010359 CTTTGAGACAGGACCTTCCTAGG - Intergenic
1190221404 X:48514545-48514567 CACTGAATGTGGAGCTGCCTCGG + Exonic
1191854169 X:65609338-65609360 CTTAAACTCAAGAGCTGCCTTGG - Intronic
1192533331 X:71908391-71908413 CCTCGAATAAGGGGCTGCCTTGG - Intergenic
1196520841 X:116668832-116668854 CTTGATGTCAGGAGCTGCCTGGG - Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198102897 X:133437315-133437337 CTTTGAATCATGAGCAGTCGGGG - Intergenic
1198775937 X:140178902-140178924 CTTTGCATGAGCAGCTGTCTGGG - Intergenic
1199805318 X:151294124-151294146 CTTTGAATCCAGAGCTGTGTGGG - Intergenic
1200207740 X:154329421-154329443 CTTTGAATCTGCAGCTTCCCAGG - Intronic
1201229948 Y:11854473-11854495 CTCTGAATCAGGAGTTATCTGGG - Intergenic
1202366544 Y:24169655-24169677 CCATGAATCAGCAGCTGCCAGGG - Intergenic
1202504238 Y:25500468-25500490 CCATGAATCAGCAGCTGCCAGGG + Intergenic