ID: 977455351

View in Genome Browser
Species Human (GRCh38)
Location 4:97252740-97252762
Sequence CTTTTGTTGTTGATGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 442}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977455351_977455353 -2 Left 977455351 4:97252740-97252762 CCTTTTGTCATCAACAACAAAAG 0: 1
1: 1
2: 2
3: 38
4: 442
Right 977455353 4:97252761-97252783 AGCAAAAGGCAGCTGAACTCTGG No data
977455351_977455354 19 Left 977455351 4:97252740-97252762 CCTTTTGTCATCAACAACAAAAG 0: 1
1: 1
2: 2
3: 38
4: 442
Right 977455354 4:97252782-97252804 GGTTAATAAATCATTTTCTGTGG 0: 1
1: 0
2: 2
3: 21
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977455351 Original CRISPR CTTTTGTTGTTGATGACAAA AGG (reversed) Intronic
901372024 1:8807056-8807078 ATTTTGTTGTTGTTGAGACAGGG + Intronic
901372895 1:8815894-8815916 CTGTTGTTGTTGAGGTCGAAGGG - Intronic
901724686 1:11231737-11231759 TTTTTGTTGTTGTTGAGACAGGG + Intronic
901873780 1:12154273-12154295 CTTTTGTTGTTGTTGTTACAAGG - Intergenic
903110273 1:21126988-21127010 TTGTTGTTGTTGTTGAGAAAAGG + Intronic
903186180 1:21630555-21630577 CTTTTGTTGTTGTTAAGAAATGG + Intronic
903196230 1:21690528-21690550 TTTTTGTTGTTGTTGAGACAGGG + Intronic
904075978 1:27842863-27842885 TTTTTGTTGTTGCTGAAGAAAGG - Intronic
904582371 1:31554606-31554628 TTTTTGTTGTTGTTGATACAGGG + Intergenic
905468207 1:38171852-38171874 CCTTTTTTCTTGATCACAAATGG + Intergenic
906474035 1:46155313-46155335 TTTTTGTTGTTGTTGAGACAGGG - Intronic
907083786 1:51649878-51649900 TTTTTGTTGTTGTTGAAAAAAGG + Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
910722767 1:90304976-90304998 CTTTTGTTGCTCATGCCAAATGG - Intergenic
911049570 1:93659186-93659208 TTTTTGTTGTTGTTGAGACAGGG + Intronic
911710755 1:101069455-101069477 ATTTAGTTGTTAATGAGAAATGG + Intergenic
913137871 1:115910302-115910324 CTTTTTTTGTTGTTGAGACAGGG - Intergenic
913215976 1:116620745-116620767 TTTTTGTTGTTGTTGAGACAGGG + Intronic
913361433 1:117985037-117985059 ATTTTGTAGTTGATCTCAAAAGG + Intronic
914701945 1:150142669-150142691 CTGTTGTTGTTGTTGAGACAGGG + Intronic
914895430 1:151667436-151667458 CTTTTATTGTTAAGGCCAAAAGG - Intronic
915426391 1:155830591-155830613 TTTTTGTTGTTGCTGAGACAGGG + Intronic
915909840 1:159908119-159908141 TTTTTGTTGTTTTTCACAAATGG + Intergenic
916239727 1:162626938-162626960 GGTTTGTTATTGATGCCAAATGG + Intergenic
916502257 1:165397069-165397091 CTTTTGATGGTCATGACAAGGGG - Intergenic
916762005 1:167825476-167825498 TTTTTGTTGTTGTTGAAACAGGG - Intronic
917273896 1:173309284-173309306 ATTTTATTGTTGATCTCAAAGGG + Intergenic
918072986 1:181147339-181147361 CTGTTGTTGTTTTTGAGAAAGGG - Intergenic
920605380 1:207378005-207378027 CATTTGTTGTTTGTGACAAAGGG - Intergenic
920714205 1:208324223-208324245 TTTTTCTTGCTGATGTCAAAAGG + Intergenic
920740648 1:208578341-208578363 CTGTTGTTGCTGCTGGCAAACGG + Intergenic
921452127 1:215321654-215321676 ATTTTGATATTGCTGACAAAGGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921973491 1:221176326-221176348 CTGTTGTTGTTGTTCATAAATGG - Intergenic
923544184 1:234912285-234912307 CTTTTGTGGTTGTTGTCAGAGGG + Intergenic
923592762 1:235334333-235334355 CTTTTGTGGTTGATTAAAATAGG + Intronic
924052232 1:240091271-240091293 TTTTTGTTGTTGTTGACAGAAGG - Intronic
1063280393 10:4623120-4623142 CTTTTCTACTTGAAGACAAATGG - Intergenic
1064873642 10:19968317-19968339 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1065816732 10:29489552-29489574 TTGTTGTTGTTGTTGAGAAAGGG + Intronic
1066668821 10:37815698-37815720 TTTTTGTTGTTGTTGAAAAGTGG + Intronic
1067260856 10:44690162-44690184 ATTTTGTTGTTGTTGAAAATTGG + Intergenic
1067853569 10:49770503-49770525 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1068667052 10:59687951-59687973 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1069505127 10:68990533-68990555 ATTTTGTTGTTGTTGAGAAAAGG - Intronic
1071307615 10:84313061-84313083 TTTTTGTTGTTGTTGAGATAGGG - Intergenic
1071479360 10:86053230-86053252 CTTTTGTTTTTTATTACACAAGG - Intronic
1071541320 10:86486948-86486970 CTTTTTTTGTTGTTGAGACAGGG - Intronic
1071593148 10:86895610-86895632 ATTGTCTTGATGATGACAAAAGG + Intronic
1072526955 10:96280352-96280374 TTTTTTTTGTTTATGTCAAACGG - Intergenic
1073198646 10:101716478-101716500 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1074083205 10:110184299-110184321 CTTTTTTTTTTGAAGACTAACGG + Intergenic
1075230262 10:120670452-120670474 CATTTGTTTTAGAAGACAAATGG - Intergenic
1075792677 10:125096097-125096119 CTTTTTTTGTGTTTGACAAAGGG - Intronic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1076134295 10:128034988-128035010 TTGTTGTTGTTGTTGACACAAGG + Intronic
1076173661 10:128346263-128346285 ATTTTGTTGTTGTTGAGACAGGG + Intergenic
1076660435 10:132052217-132052239 GTTTTGTTGTTGTTGAGACAGGG - Intergenic
1077312513 11:1896541-1896563 CTTTTGTTGTTGATTCCATCGGG + Intergenic
1077889542 11:6409074-6409096 TTGTTGTTGTTGTTGAGAAAGGG + Intronic
1081782808 11:45724833-45724855 CTTGTGTTATTTATAACAAAAGG + Intergenic
1081848306 11:46257219-46257241 CTTTTGTTTTTAATGAGACAGGG + Intergenic
1082211544 11:49508722-49508744 ATTTTGTTGTTCATTTCAAATGG - Intergenic
1082864113 11:57882847-57882869 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1083010318 11:59391073-59391095 ATTATGTTTTTGAGGACAAACGG - Intergenic
1083211869 11:61193338-61193360 CTTTTGTTGTTGTTGAAACAGGG + Intergenic
1083224327 11:61275046-61275068 TTTTTGTTGTTGTTGACATGGGG - Intronic
1083992446 11:66255034-66255056 CTTTTGTTCTTCATGACACTGGG - Intergenic
1085175270 11:74480968-74480990 TTTTTGTTGTTGTTGAAACAGGG - Intergenic
1085869468 11:80332415-80332437 CATTTATTAATGATGACAAAAGG + Intergenic
1086638103 11:89116353-89116375 ATTTTGTTGTTCATTTCAAATGG + Intergenic
1087394676 11:97582829-97582851 CTTTTGTTATTGGTGACAACTGG - Intergenic
1087740570 11:101882533-101882555 CACTTCTGGTTGATGACAAAAGG + Intergenic
1088436182 11:109815575-109815597 CTTCTGTTGGTGACGACAAGTGG + Intergenic
1089189514 11:116643938-116643960 CTTTAGGTGTTGGTGCCAAACGG - Intergenic
1092366228 12:7879376-7879398 CTTTTTTTGTTGTTGAGACATGG - Intronic
1092412804 12:8267273-8267295 CTTTTGTTGTTGTCGAAACAGGG + Intergenic
1093557122 12:20489744-20489766 ATTTAGATGTTGATGACAGATGG + Intronic
1093764773 12:22950737-22950759 GTTTTGTTGTTGAAGCCACATGG - Intergenic
1094249621 12:28344582-28344604 CTTTTATTTTTGATGACAACTGG - Intronic
1094260029 12:28484348-28484370 CTGTTGTTTTTGCTGACAGATGG - Intronic
1094669126 12:32551924-32551946 GCTTTGTTGGTGGTGACAAATGG - Intronic
1095313695 12:40731761-40731783 CTGTTTTTGTTGATTAGAAATGG - Intronic
1095451403 12:42334815-42334837 CTTCTGGAGTGGATGACAAATGG - Intronic
1095655075 12:44659774-44659796 TTTTTGTTGTTGAAAAAAAAGGG - Intronic
1095870513 12:47022162-47022184 GTTTTGCTGTTGAAGACAGAAGG + Intergenic
1096099473 12:48960725-48960747 TTGTTGTTGTTCATGTCAAATGG + Intergenic
1097160665 12:57044393-57044415 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1098271084 12:68770825-68770847 TTTTTGTTGTTGTTGAGACAGGG - Exonic
1098727506 12:73987112-73987134 TTTTTGTTGTTGTTGAAAACTGG + Intergenic
1099323156 12:81177234-81177256 GTTTTGTTGTGGTTTACAAAGGG - Intronic
1099335327 12:81348902-81348924 ATTTTGTTCTTGATTACAAATGG + Intronic
1100007881 12:89916098-89916120 ATTTTGTCATTGATGACAAAGGG + Intergenic
1100336026 12:93630504-93630526 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1100844762 12:98646055-98646077 ATTTTGTTGTGGGTTACAAAAGG + Intronic
1101216495 12:102590530-102590552 TTTTTGTTGTTGATGTGAATGGG + Intergenic
1101457096 12:104845282-104845304 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1103876201 12:124129282-124129304 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1104700571 12:130900582-130900604 ATTTTGTTGTTTAAGGCAAAAGG + Intergenic
1105219711 13:18314224-18314246 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1106248173 13:27966032-27966054 CTTTTGTTGTGGTTTGCAAAGGG - Intronic
1107098414 13:36561268-36561290 TTTTTGTTATGGATGACACATGG - Intergenic
1108085599 13:46788320-46788342 CTTTTCTTGTTGATGACTGACGG + Intronic
1109493378 13:63133142-63133164 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1110780060 13:79455038-79455060 ATTTTGTTGTTTATGTCAAAAGG + Intergenic
1111059243 13:82990654-82990676 CTGTTGTTGTTGTTGAGACAGGG - Intergenic
1111148231 13:84213905-84213927 CTTTACTTGTTGATGATAAGAGG + Intergenic
1111358044 13:87136610-87136632 TTTTTATTGTTGATGACAGGTGG - Intergenic
1111629355 13:90829249-90829271 CTTTTGTTTTTAGTGACATAAGG + Intergenic
1112249064 13:97762197-97762219 TTGTTGTTGTTGTTGAAAAATGG - Intergenic
1114844446 14:26304127-26304149 CTGTTGTTGTTGATGATTATAGG - Intergenic
1115314951 14:32015654-32015676 CTTTTGCTGTTGCTGTAAAATGG - Intronic
1115956654 14:38788129-38788151 CTGCTGCTGTTGATCACAAAAGG - Intergenic
1116875901 14:50111703-50111725 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1116887587 14:50236050-50236072 CTTTTGTTGTTGTTGAGATGGGG + Intergenic
1117111476 14:52460725-52460747 CTTTATTTGTTGATTAAAAAAGG + Intronic
1117721127 14:58629899-58629921 ATTTAGTTGTTCATGAAAAATGG + Intergenic
1118172982 14:63407755-63407777 CTTTTGGTGTTGAGGTCATAAGG + Intronic
1118750246 14:68802188-68802210 TTTTTGTTGTTGTTGAAAACTGG + Intergenic
1118913921 14:70085243-70085265 GTTTTGTTGTGCATGAAAAATGG - Intronic
1118955155 14:70474603-70474625 TTTTTGTTGTTTATGACAATAGG - Intergenic
1119677763 14:76568812-76568834 TTTTTGTTGTTGTTGAGATAGGG - Intergenic
1120580971 14:86248288-86248310 CTTTAGTAGTTGGTGCCAAATGG - Intergenic
1120658067 14:87219467-87219489 CTTTTCTTGATGACAACAAAAGG + Intergenic
1120696598 14:87651795-87651817 CTCATGTTGGTGATCACAAAGGG + Intergenic
1122165595 14:99821189-99821211 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1125168511 15:36739217-36739239 TTTTTGTTGTTGTTGAAACAGGG - Intronic
1125571757 15:40725463-40725485 CTTTTGTTGTGAATGAAAGAGGG - Intronic
1125582609 15:40797361-40797383 TTTTTGTGGTTGATGAAACAGGG - Intronic
1125668705 15:41453712-41453734 TTTTTGTTGTTGTTGAGAAAGGG - Intronic
1125669872 15:41463482-41463504 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1126419856 15:48460033-48460055 CATTTGTTGTTCATGATTAAGGG - Intronic
1126602923 15:50447243-50447265 TTTTTGTTGTTGTTTTCAAACGG + Intronic
1126678545 15:51182773-51182795 CTTTTGTTGGTGAGGAAGAAAGG + Intergenic
1127750842 15:62041127-62041149 CTTCTTTTTTTTATGACAAAAGG - Intronic
1128202469 15:65820992-65821014 CTTTTCTTGCTGATGATAGAGGG + Intronic
1128481337 15:68042268-68042290 TTTTTGTTGTTGTTGAAAACTGG + Intergenic
1128611666 15:69078775-69078797 TTTTTGTTGTTGTTGAGACAAGG + Intergenic
1129513384 15:76141028-76141050 GTTTTGTTGTTGTTGAGACAGGG - Intronic
1129651515 15:77494134-77494156 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1131041169 15:89268101-89268123 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1131964409 15:97825616-97825638 TTTTTGTTGTTGACTTCAAATGG + Intergenic
1132919475 16:2378057-2378079 ATTTTGTTGATGTGGACAAATGG + Intergenic
1133354006 16:5122771-5122793 TTTTTGTTGTTGTTGAAACAGGG + Intergenic
1134454481 16:14384571-14384593 GTTTTGTTGTTTTTGAGAAAAGG + Intergenic
1134536478 16:15030588-15030610 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1135701320 16:24634964-24634986 GTTTTGTTGTTGTTGAGACAGGG + Intergenic
1135945788 16:26863807-26863829 CTTTTTTTGTTTTTGAGAAAGGG - Intergenic
1138951059 16:61913845-61913867 TTTTTGTTTTTGATTAGAAATGG - Intronic
1139819307 16:69707865-69707887 GTTTTGATGCTGATGACAAAGGG - Intronic
1139859590 16:70010199-70010221 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1140463895 16:75163616-75163638 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1140554327 16:75903903-75903925 CTTTTGTTATTTTTCACAAAGGG + Intergenic
1141156366 16:81599971-81599993 CTTTTTTTAATGATGACAGAAGG - Intronic
1142020522 16:87779385-87779407 CTTCTGTTGACGTTGACAAAGGG - Intergenic
1142775256 17:2132797-2132819 CTTTTGTTGTTGTTGAGACAGGG + Intronic
1144173816 17:12685291-12685313 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1144470109 17:15531824-15531846 CTTTTGTTGTTGTTGAAAACTGG + Intronic
1144926234 17:18811828-18811850 CTTTTGTTGTTGTTGAAAACTGG - Intergenic
1145354454 17:22128636-22128658 CTTTTGTTTTTGTTAACAAGTGG - Intergenic
1146018673 17:29254857-29254879 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1146965807 17:37028775-37028797 CTGTTGTTGTTGTTGAGACAGGG - Intronic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1148510606 17:48165914-48165936 CTTTTGTTTTTCATTCCAAATGG - Intronic
1148871256 17:50659977-50659999 TTTTTGTTGTTGTTGAGAAAAGG - Intronic
1149167517 17:53770727-53770749 CCTTTGCTTTTGATGACACAAGG + Intergenic
1149272488 17:54995348-54995370 CTTTTGTTGCTGGTAACATAGGG + Intronic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1149748241 17:59120751-59120773 CTATTGTTGCTGTTGAAAAATGG - Intronic
1150090609 17:62321629-62321651 ATTTTGTTGTTGTTGAGACAGGG - Intergenic
1150254302 17:63731869-63731891 CTTTTGTTTTTTATGAGACAGGG + Intronic
1150360950 17:64533598-64533620 GTTTTGTTGTTGTTGAGACAGGG - Intronic
1150461074 17:65353084-65353106 CTTTTATTTTTGATCATAAATGG - Intergenic
1151918267 17:77134764-77134786 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1153657841 18:7301208-7301230 ATTTTGTTGTTGTTGAAAACTGG + Intergenic
1155171913 18:23273125-23273147 GTTTTGTTGTTGATTTTAAATGG + Intronic
1155198005 18:23493127-23493149 TTTTTGTGGTTGTTGATAAAAGG - Intergenic
1155419237 18:25636567-25636589 CTTTGGCTGATAATGACAAAAGG + Intergenic
1155879344 18:31124333-31124355 GTTTTGCTGTATATGACAAATGG - Intergenic
1156033267 18:32738000-32738022 TTTCTGTTGTTGGTCACAAAAGG + Intronic
1156437141 18:37144541-37144563 CTTTTGTTGTTGTTGAGACAGGG + Intronic
1156777244 18:40806752-40806774 TTTTTGTTTTTGATTACATAAGG + Intergenic
1158442230 18:57486651-57486673 CTTTTGTAATAGATGAAAAAAGG + Exonic
1158864775 18:61627761-61627783 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1159086105 18:63793671-63793693 ATTTTTTTGTTGTTGAGAAAGGG + Intronic
1159181797 18:64916853-64916875 TTTTTGTTGTTGAGGGGAAAGGG + Intergenic
1159634770 18:70791003-70791025 CTTTTTTTTGTGAAGACAAATGG - Intergenic
1159884708 18:73893011-73893033 CTTTCTATGTTGATGAAAAATGG - Intergenic
1159897049 18:74007382-74007404 CTTTTCTTCTTAATGACAATGGG - Intergenic
1160924312 19:1535867-1535889 CTTTTGTTGTTGTTGAGACAGGG - Intergenic
1160976264 19:1794196-1794218 CTTTTGTTGTTGATGGGGCACGG + Intronic
1161526409 19:4758802-4758824 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1161893699 19:7063921-7063943 ATTTTGTTGTTGTTGAGAAGGGG + Intergenic
1162515467 19:11144768-11144790 TTTTTTTTGTTGTTGACACAGGG + Intronic
1162903834 19:13811521-13811543 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1163100752 19:15094811-15094833 CTTTTGTTGTTGCTGAATTAAGG - Intergenic
1165166117 19:33858061-33858083 CTTTTGTTGTTGTTGTTACATGG - Intergenic
1165557310 19:36645219-36645241 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1166611210 19:44199179-44199201 CTGTTGTTGTTGTTGAGACAGGG + Intergenic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
1167540471 19:50083858-50083880 CTTTTTTTGTTTTTGACAAAGGG + Intergenic
927601185 2:24442999-24443021 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
927834092 2:26377872-26377894 TTTTTGTTGTTGTTGAAAACTGG + Intronic
928014373 2:27641598-27641620 CTTTTCTTGTTGTTGAGAAAGGG + Intronic
928432064 2:31228285-31228307 CTGGTGTTGTGGATGAGAAAGGG + Intronic
928989460 2:37217392-37217414 TTTTTGTTGTTGTTGAAATAGGG - Intronic
929105256 2:38359128-38359150 CTTTTGTTGTTGGCTAGAAAGGG - Intronic
929719020 2:44347322-44347344 TTTTTGTTGTTGTTGAGACAGGG - Intronic
929891979 2:45925771-45925793 CCTGTGATGTTGATGACAGAAGG + Intronic
930317352 2:49813863-49813885 CTTTTGTTGGAGATGATAATGGG + Intergenic
930764562 2:55071532-55071554 TTTTTTTTTTTGATGGCAAATGG - Intronic
930817673 2:55616271-55616293 CTTTTGTTCTTAATGAGGAAAGG - Intronic
931193666 2:60029261-60029283 CTCTTGTTTTTGATGGCAGAAGG - Intergenic
931869178 2:66440838-66440860 CTTTTGTTTTTTATGACAGCCGG + Intronic
933275074 2:80275233-80275255 CTTTTGTTGATCATACCAAAAGG + Intronic
933911389 2:86943701-86943723 TTTTTATTGTTGATGTTAAAAGG + Intronic
934184336 2:89658295-89658317 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
934294622 2:91732433-91732455 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
934776030 2:96938025-96938047 TTTTTGTTGTTGTTGAGACAAGG - Intronic
934902907 2:98175092-98175114 TTTTTGTTGTTGTTGACAACTGG - Intronic
935991259 2:108720736-108720758 TTTTTATTGTTGATGTTAAAAGG + Intronic
936427162 2:112431945-112431967 TTTTTATTGTTGATGTTAAAAGG - Intronic
936869405 2:117116663-117116685 TTTTTGTTGTTGATCACAGGTGG - Intergenic
937367116 2:121271254-121271276 CTTTTGCTTTTTAAGACAAATGG - Intronic
938035975 2:128035284-128035306 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
938045506 2:128115569-128115591 CTATTGTTGTTGATGTTATAGGG + Intronic
939992952 2:148893134-148893156 GTTTTGTTTTTAATCACAAATGG + Intronic
942119954 2:172766686-172766708 CTGTTGGTGTTGATGAAGAAAGG - Intronic
942280821 2:174362297-174362319 TTTTTGTTTTTGTTGAGAAAAGG - Intronic
942621428 2:177848078-177848100 TATTTGTTGTTGAAGACTAATGG + Intronic
942969022 2:181934625-181934647 CTTTAGTCTGTGATGACAAATGG + Intergenic
944660318 2:201916316-201916338 CCTTTCTTGCTGATGATAAAAGG - Intergenic
945587185 2:211680169-211680191 TTGTTGTTGTTGATGGCAGAAGG + Intronic
945958174 2:216105620-216105642 CTTTTGTTGTGGAGGAGGAAGGG + Intergenic
946298758 2:218809109-218809131 TTTTTCTTGTTGATTACATAAGG + Intronic
946673438 2:222131183-222131205 TTTTTGTTGTTGTTGTCACATGG + Intergenic
946719937 2:222593851-222593873 TTTTTGTTGTTGTTGAGACAGGG - Intronic
946932975 2:224689784-224689806 CTTTTGTTGTGGATGACTGGAGG + Intergenic
947786630 2:232828157-232828179 TTTTTGTTTTTGAAGACATAGGG + Intronic
1168901284 20:1367285-1367307 CTATTGTTGCTGTTAACAAATGG + Intronic
1170923915 20:20705211-20705233 TTTTTGTTGTTGTTGATACAGGG + Intronic
1173455776 20:43200034-43200056 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1174239186 20:49119196-49119218 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1174382872 20:50168402-50168424 CTCTTTTTGTTGAAGACAACTGG - Intergenic
1175148779 20:56916591-56916613 CGTTTCTTCATGATGACAAACGG - Intergenic
1175352862 20:58337930-58337952 ATTTTGTTTTTGATGTGAAATGG + Intronic
1176116784 20:63435379-63435401 TTTTTGTTGTTGTTGAGATAGGG - Intronic
1176193918 20:63828154-63828176 GGTTTGCTGGTGATGACAAAGGG - Intronic
1176902769 21:14463032-14463054 ATTATGCTGTGGATGACAAAAGG - Intergenic
1177343704 21:19839884-19839906 CTTCTGTTGTTGATGTCATAAGG - Intergenic
1178451095 21:32700837-32700859 CTGATGATGTTGATGACAAATGG + Intronic
1179078850 21:38151292-38151314 CTTTTGTTGTTGTTGACAAAAGG + Intronic
1180645388 22:17334382-17334404 CTCCTGTTGTTGATGACAAACGG - Intergenic
1180817316 22:18799113-18799135 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1181203506 22:21233434-21233456 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1181948328 22:26536292-26536314 TGTGTGTTGTTGATGACGAAGGG + Exonic
1183454732 22:37916335-37916357 CTTTTCTTTTTTATTACAAAAGG - Intronic
1183876269 22:40784767-40784789 TTTTTGTTGTTGTTGAGATAGGG - Intronic
1184052120 22:42015044-42015066 TTTTTGTTGTTGTTGAAAACTGG + Intronic
1184855433 22:47143998-47144020 CTTTAGTTGGTGATGTCCAAAGG + Intronic
1185033038 22:48455265-48455287 CTTTTGTTTTTCTTGAAAAATGG - Intergenic
1203223415 22_KI270731v1_random:61980-62002 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1203267415 22_KI270734v1_random:24840-24862 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
949528208 3:4927365-4927387 CTTTCATTTTTAATGACAAAAGG + Intergenic
951517685 3:23579515-23579537 TTGTTGTTGTTGTTGAGAAAGGG - Intronic
952120629 3:30239525-30239547 TTTTTGTTGTTGTTGAATAAGGG + Intergenic
954046052 3:47931482-47931504 CTTTTTTTGTTGTTGAGACAGGG + Intronic
954552098 3:51490422-51490444 TTTTTGTTGTTGTTGAGACAGGG - Intronic
954560364 3:51551137-51551159 CTTTTTTTGTTGTTGAGACAAGG + Intronic
954885070 3:53865906-53865928 ATTTTGTTGTTCATGTTAAAAGG - Intergenic
955612967 3:60777119-60777141 CTTTTGGTAATGTTGACAAAAGG + Intronic
956422826 3:69102311-69102333 CTTTTGTTGTTGTTGAGATGGGG + Intronic
957057906 3:75458463-75458485 TTTTTGTTGTTGTTGAAACAGGG + Intergenic
957378141 3:79387313-79387335 TTTTTAATGTTGTTGACAAAGGG - Intronic
957821418 3:85379736-85379758 GTATTTTTGTTGATGAAAAAAGG - Intronic
957981195 3:87512581-87512603 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
958571963 3:95895268-95895290 CATTTGTTGTTTATGAGATATGG + Intergenic
958727999 3:97929639-97929661 CTTTTGTTGTTTATGAGAGGTGG + Intronic
960316190 3:116179920-116179942 TTTTTGTTGTTGTTGTTAAATGG + Intronic
961890365 3:130125924-130125946 CTTTTGTTGTTGTCGAAACAGGG + Intergenic
961901886 3:130220990-130221012 CTGTTGTTGTTGCTTAAAAAGGG - Intergenic
962621797 3:137187550-137187572 CTGTTGTTGTTTCTGACAAAGGG + Intergenic
963444643 3:145388600-145388622 TTTTTGTTGTTGTTGAAAACTGG - Intergenic
963451616 3:145489563-145489585 CTTTTGTTGTGTAAGACACAAGG + Intergenic
963784443 3:149519610-149519632 ATTTTGTAGCTGATGACAAAAGG - Exonic
963909382 3:150802452-150802474 ATTTTGTGTTCGATGACAAAAGG - Intergenic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964201839 3:154126226-154126248 ATTCTGTAGTTGATGAGAAAAGG + Intronic
964513100 3:157475592-157475614 CTATAGTGGTTGATGACACAGGG - Intronic
964601234 3:158503462-158503484 CTTTGGTAGCTGAAGACAAAGGG - Intronic
965138274 3:164802680-164802702 CTTTTGTGGTGGATTAAAAATGG - Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
965845535 3:172956844-172956866 ATATTGTTATTGATGCCAAATGG - Intronic
966202480 3:177371659-177371681 CCTTTGGTGTTTATCACAAAAGG + Intergenic
966681650 3:182647828-182647850 TTTTTGTTGTTTATGAAAATGGG - Intergenic
967093350 3:186154088-186154110 GTTTTGTTGTTGTTGAGACAAGG - Intronic
968149149 3:196323377-196323399 GTTTTGTTGTTGCTGAGACAGGG - Intronic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
968781622 4:2586657-2586679 CATTTGTTGTTGTTGAGAACAGG + Intronic
968888846 4:3355329-3355351 CTCTTGTTCCTGATGGCAAAGGG - Intronic
969551821 4:7873917-7873939 CTTTTGTTCTTGGCCACAAATGG - Intronic
970824821 4:20257111-20257133 ATTTTATTATTGATAACAAAAGG + Intronic
971091194 4:23347534-23347556 TTTTTGTTGTTGTTGTTAAAGGG + Intergenic
971442870 4:26709044-26709066 TTGTTGTTGTTGTTGAAAAAGGG + Intronic
972600293 4:40566059-40566081 TTTTTGTTGTTGTTGAGACAGGG - Intronic
972687609 4:41366181-41366203 CTGATGTTGCTGATGATAAAAGG + Intronic
974107908 4:57491719-57491741 TTTTTGTTGTTGCTGTCAATGGG - Intergenic
974978273 4:68919272-68919294 CTGTTGGTGGTAATGACAAATGG + Intergenic
975173623 4:71261498-71261520 CTTGTGTTTTTGATGGCAATGGG + Intronic
975580234 4:75900442-75900464 TTTTTGTCCTTGGTGACAAAAGG - Intronic
975743301 4:77451666-77451688 CTGGTGTTGATTATGACAAATGG + Intergenic
977407456 4:96618036-96618058 CTTTTCTTTTTAATCACAAAGGG + Intergenic
977455351 4:97252740-97252762 CTTTTGTTGTTGATGACAAAAGG - Intronic
978142011 4:105328776-105328798 CTTTTGTTCTTTTTGGCAAATGG + Intergenic
978268225 4:106853707-106853729 CTTTTGTTGTTGATCTGAGAAGG + Intergenic
979702334 4:123684055-123684077 CTTTTATTGTTTCTGACAAGAGG + Intergenic
980824323 4:138055193-138055215 CTTTTGTTCTTGATGTTTAAAGG + Intergenic
981882733 4:149634405-149634427 CTTGTATTGTAGATTACAAAAGG + Intergenic
982059559 4:151591182-151591204 CTTATGTGGTTGATGAAGAAAGG + Intronic
982199682 4:152948256-152948278 CTTTTGTTTTTTATGTCAAAGGG - Intronic
982355781 4:154466127-154466149 TTCTAGTTGTTTATGACAAAAGG - Intronic
982387915 4:154832757-154832779 CTTTTTTTGTGGATGATGAAAGG + Intergenic
982948578 4:161660183-161660205 CTTTTGTTTTTGATTACTTAGGG + Intronic
983107509 4:163707558-163707580 CTTCTGTTGCTGATGGCAATAGG + Intronic
983198309 4:164833153-164833175 TTTTTGTTGTTGTTAATAAATGG - Intergenic
984133373 4:175905845-175905867 CTTTTTTTCTTAATGACGAAAGG - Intronic
984714607 4:182914814-182914836 TTCCAGTTGTTGATGACAAAAGG + Intronic
985355934 4:189118831-189118853 TTTTTGTTGTTGTTGTTAAATGG - Intergenic
985985670 5:3514215-3514237 CTTCTGATTTTGATGTCAAACGG - Intergenic
986226729 5:5822854-5822876 TTTTTGTTGATGATGAAAAGAGG + Intergenic
986497626 5:8361525-8361547 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
986900573 5:12427273-12427295 CCTTTGTTGTTCATGTCTAAAGG - Intergenic
991448957 5:66731598-66731620 TTTTTTTTGTTGTTAACAAAAGG + Intronic
991659434 5:68935263-68935285 CCTTTGTTTTTGATGCCTAATGG + Intergenic
992130776 5:73690689-73690711 CTTTTGTTTTTGTTGAGATAGGG - Intronic
992440259 5:76792024-76792046 CTTTTGTTGCTGTTGTGAAACGG - Intergenic
993883859 5:93394669-93394691 CTCTGGTAGTTGAAGACAAAGGG - Intergenic
994709094 5:103244310-103244332 GTTTTCCTGGTGATGACAAAAGG + Intergenic
995563554 5:113409297-113409319 TTTTTGTTGTTTATGAGAATGGG - Intronic
995625892 5:114076239-114076261 CTTTGGTAGTTGATGCCCAAAGG + Intergenic
996393002 5:122983608-122983630 TTTTTGTTGTTGTTGAAACAGGG + Intronic
996597309 5:125220184-125220206 CTTTTGTGCTTGATGAAAGAAGG - Intergenic
996701637 5:126456215-126456237 CTTTTTTTGTTGTTGAGACAGGG + Intronic
996760478 5:126981720-126981742 CCTTTGTTGTTTAAGAAAAAAGG - Intronic
997134866 5:131314411-131314433 TTTTTGTTGTTGTTGAGACAGGG + Intronic
998020035 5:138761759-138761781 TTTTTGTTGTTGTTGATACAGGG + Intronic
998235432 5:140394720-140394742 TTTTTGTTGTTGTTGAGACAAGG + Intergenic
998614830 5:143728415-143728437 CTTTTCTGGTTGGTGACCAAGGG - Intergenic
999161957 5:149508932-149508954 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1000075785 5:157784124-157784146 CTTTTTTTGTTGTTGAAATAGGG - Intergenic
1000613241 5:163398602-163398624 CCTTTGCTGTTTATGACCAAAGG - Intergenic
1001208708 5:169789964-169789986 CTAGTGTTGTTTATTACAAAAGG - Intronic
1003211672 6:4073851-4073873 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1004248774 6:14005065-14005087 CTTTTGTTGATGAAGGCACAAGG + Intergenic
1004918984 6:20358457-20358479 TATTTGTTTTTAATGACAAATGG + Intergenic
1004956385 6:20732281-20732303 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1005091518 6:22061806-22061828 CTTTTGGTGATTAGGACAAAAGG - Intergenic
1005116230 6:22340490-22340512 CTTTTGTGGTTGATTACCAGCGG - Intergenic
1005464477 6:26099199-26099221 GTTTTGTTGTTGTTGAGACAGGG + Intergenic
1005741705 6:28797182-28797204 CTGTTGGTGTTGATGAGAATTGG + Intergenic
1006359872 6:33581373-33581395 TTTTTGTTGTTGTTGAGACAAGG - Intergenic
1006401170 6:33818340-33818362 GTTTTCTGGGTGATGACAAAGGG + Intergenic
1006523480 6:34585712-34585734 CATTTGTTGTTTGTGACAGAAGG + Intergenic
1007085213 6:39139412-39139434 TTTTTCTTGTTGTTGACACAAGG - Intergenic
1007939360 6:45763712-45763734 GTTTTGTGGTTTATAACAAATGG + Intergenic
1008076722 6:47153299-47153321 TGTTTGTTATTGATGATAAATGG - Intergenic
1008525666 6:52404435-52404457 GTTTTGTTGTTGTTAATAAAAGG + Exonic
1010186687 6:73152454-73152476 TTTTTGTTGTTTTTGACTAAGGG + Intronic
1010528066 6:76927751-76927773 CTTTTGGTATTCATGTCAAATGG + Intergenic
1010694206 6:78949694-78949716 TTTTTGTTGTTAATGAGATAGGG + Intronic
1010758134 6:79691145-79691167 TTTTTGTTGTTGTTGAGATAGGG - Intronic
1010950807 6:82034881-82034903 CTGTTGTTGTTGTTGAGATAGGG + Intergenic
1011019307 6:82793702-82793724 CTTTTGTTTATGATGAGAGATGG - Intergenic
1011301578 6:85879782-85879804 ATGTTTTTGTTTATGACAAAAGG + Intergenic
1011319958 6:86080402-86080424 CCTTGGTAGTTGAGGACAAAGGG - Intergenic
1011609274 6:89134478-89134500 CTTTCTTTGGTGGTGACAAAAGG + Intergenic
1012149809 6:95734083-95734105 CTTTAGTTGTAGATGAACAATGG - Intergenic
1012275161 6:97264219-97264241 CTTTTGTTGTAGATGACTCAGGG - Intronic
1012392411 6:98757469-98757491 TTTTTGTTGTTGTAGAGAAAGGG + Intergenic
1013568262 6:111391980-111392002 ATTTTGTTGTTGTTGAGACAAGG - Intronic
1013965979 6:115955851-115955873 ATTTTGATGTTTATTACAAATGG - Intronic
1014266165 6:119280177-119280199 ATTTAGTTGTTGATGACTCATGG + Intronic
1014436533 6:121426820-121426842 CTTTGGTTCTTGATGATAAGTGG - Intergenic
1015085372 6:129284146-129284168 CTTTTGCTGATTATGTCAAATGG + Intronic
1015739821 6:136442004-136442026 CTGTTGTTGTTGTTGAGACAGGG - Intronic
1016475892 6:144427587-144427609 TTTTTGTTGTTGATAATAAAAGG + Intronic
1016632978 6:146253419-146253441 ATTTTATTGTTGATGAAAAATGG + Intronic
1016921449 6:149298598-149298620 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1017463320 6:154671669-154671691 TTTTTGTTGTTGTTGAGACAGGG - Intergenic
1017492382 6:154955858-154955880 CTTTTGTTGTTGTTGAGACAGGG + Intronic
1017505974 6:155068922-155068944 ATTTTGTTGTTGTTGAGACAGGG + Intronic
1018355354 6:163009140-163009162 ATTTTGTTGTTGTTGTCACATGG - Intronic
1019834925 7:3373836-3373858 TCTTTGTTGTTGATTATAAATGG - Intronic
1020135760 7:5586986-5587008 CTTCTGTTGATGATGACCAGAGG - Intergenic
1020268974 7:6580907-6580929 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1020433814 7:8140776-8140798 CTTTTGTTGTTGTTGTTGAAAGG + Intronic
1021203030 7:17746645-17746667 ATTTTGTTGTTGTTGAGACAGGG - Intergenic
1021623241 7:22568343-22568365 CTTTTGTTGTGTTTGAAAAAGGG - Intronic
1022725600 7:32978733-32978755 GTTATGTGGCTGATGACAAAAGG - Intronic
1023614054 7:42000509-42000531 CTTTTCTTGCTGAGGACAAGGGG + Intronic
1024370012 7:48571844-48571866 CTTTTGTTTTTGATATGAAAGGG + Intronic
1025048012 7:55708948-55708970 GTTATGTGGCTGATGACAAAAGG + Intergenic
1025243843 7:57300915-57300937 TTTTTCTTTTTGATGACTAAGGG + Intergenic
1030624297 7:111827449-111827471 CTTGTGTTTTTGATGACTATGGG - Intronic
1031994033 7:128216817-128216839 TTTTTGTTGTTGTTGATACAGGG - Intergenic
1032027178 7:128453033-128453055 TTGTTGTTGTTGTTGAGAAAGGG - Intergenic
1032157604 7:129481861-129481883 CTTTTGTTTTTTAACACAAATGG - Intronic
1032357998 7:131228068-131228090 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1032360972 7:131254349-131254371 TTTTTGTTGTTGTTGAAAACTGG - Intronic
1032605977 7:133354212-133354234 TTTTTGTTGTTGTTGAAAACTGG + Intronic
1032661945 7:133993824-133993846 CTTTTGTTTTTCCTGATAAAAGG - Intronic
1032930752 7:136666576-136666598 TTTTGGATATTGATGACAAAGGG - Intergenic
1033028049 7:137796069-137796091 TTTTTGTTGTTGTTGAAAACTGG - Intronic
1033346625 7:140530215-140530237 ATTTTGTTGTTGTTGAGACAGGG - Intronic
1034012512 7:147545217-147545239 CTTGTATTGTTGAGCACAAAAGG - Intronic
1035216050 7:157367945-157367967 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1035345446 7:158194078-158194100 TTTTTGTTGTTGTTGAAACAGGG - Intronic
1035604073 8:917586-917608 CTTTTGTTGTTGCTGAGACAGGG + Intergenic
1037105416 8:15101011-15101033 CATTTGTTTTTTATTACAAATGG - Intronic
1037900935 8:22689349-22689371 GTTGTGTTGGTGATGACAAAGGG + Exonic
1037947717 8:22999640-22999662 CTTTTTTTGTGAATGAAAAAAGG + Intronic
1038058159 8:23881803-23881825 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1038064151 8:23944676-23944698 CTTTTGTATATGATGAAAAATGG + Intergenic
1038304376 8:26385281-26385303 TTTTTGTTGTTGTTGTTAAAGGG - Intronic
1038623025 8:29162711-29162733 CTTTAGTTTTTGGTGGCAAACGG - Intronic
1040676373 8:49756042-49756064 CTGCTGTTGTTACTGACAAAGGG + Intergenic
1041498934 8:58518644-58518666 CTTTTGTGTTTGATTAAAAATGG + Intergenic
1041863256 8:62538181-62538203 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1042744823 8:72096586-72096608 CTTTAGTTGTAGATTACAAGAGG - Intronic
1042940776 8:74105641-74105663 TTCTTGTTGTTGTTGGCAAAGGG - Intergenic
1043321526 8:78992958-78992980 TTTTTGTTGTTGTTGAGATATGG - Intergenic
1043866960 8:85385781-85385803 TTTTTATTTTTGGTGACAAATGG - Intronic
1043937047 8:86154634-86154656 TTTTTGTTGTTGTTGAAACAGGG + Intergenic
1044681476 8:94782833-94782855 CTTTTGTTAATGATAACACAAGG - Intronic
1045232964 8:100323087-100323109 TTTTTGTTTTTGTTTACAAATGG - Intronic
1046418896 8:113952910-113952932 TTTTTGTTGTTGTTGAGATAGGG + Intergenic
1046604530 8:116356226-116356248 TTTTCGTTTTTGATGACAATTGG - Intergenic
1046710822 8:117509568-117509590 TTTTTCTTCTTGATGACAAATGG - Intergenic
1049437012 8:142591224-142591246 CTTTTCTTGCTGGTGAGAAATGG - Intergenic
1049810423 8:144566085-144566107 CTTTTTTTGTTGTTGAGACAGGG - Intronic
1051028402 9:12643681-12643703 ATTTTGTCTTTGATGACAATTGG - Intergenic
1051470402 9:17433632-17433654 TTTTTGTTGTTGTTGAGACAGGG + Intronic
1051705013 9:19868986-19869008 TTTTTGTTGTTGTTGAGACATGG + Intergenic
1052089084 9:24304978-24305000 CTTTTGTTGTTGTTGTCATTGGG - Intergenic
1052937346 9:34103832-34103854 CTGTTGTTGTTGTTGAGACAGGG - Intronic
1053166808 9:35850413-35850435 TTTTTATTGCTGTTGACAAAAGG + Intronic
1055399968 9:75912847-75912869 CTCTTTTTGTAAATGACAAAGGG + Intronic
1055949348 9:81716329-81716351 CTTTTGTTGTTGTTGAGACAGGG + Intergenic
1056121721 9:83494730-83494752 TTTTTGTTGTTGTTGAGACAGGG - Intronic
1056748855 9:89330039-89330061 ATTATGATGTTGATGAAAAAAGG + Intronic
1056929672 9:90863603-90863625 CTGTGGTTAATGATGACAAATGG - Intronic
1057039042 9:91834056-91834078 CTTTTGTTCCAGCTGACAAATGG + Intronic
1057084064 9:92192503-92192525 CTTTTGTTGTTTTTGAGACAGGG + Intergenic
1057991381 9:99774018-99774040 CTTCTGTTGTTGATTAGCAATGG - Intergenic
1059587894 9:115626009-115626031 CTTTTGTTGTTTTTGCCAGAAGG + Intergenic
1059800028 9:117740987-117741009 CTTTTGGTGTTGATTAAATAAGG - Intergenic
1060647340 9:125292250-125292272 CTTTTGTTGTTGTTGTCTTATGG - Intronic
1061141445 9:128769904-128769926 GATTTGTTTTAGATGACAAATGG - Intronic
1061176015 9:128997665-128997687 TTTTTGTTGTTGTTGAGATAGGG + Intronic
1062660538 9:137629396-137629418 TTTTTGTTGTTGTTGTTAAATGG + Intronic
1187355446 X:18566156-18566178 CTTTTTTTGTTTATGAGACAGGG + Intronic
1187774849 X:22744918-22744940 GTTTACTTGGTGATGACAAAGGG + Intergenic
1188922875 X:36000331-36000353 CCTTTGTTTTTTATTACAAATGG - Intergenic
1189625864 X:42895933-42895955 ATTTTGTTGTTGTTGAGACAGGG - Intergenic
1189916545 X:45861350-45861372 CTTTTTTTGTTTTTGAAAAAGGG - Intergenic
1190706016 X:53028803-53028825 CTTTTTTTTTAAATGACAAATGG + Intergenic
1192047609 X:67692743-67692765 CTTCTTTTGTGGATGAAAAATGG + Intronic
1192070643 X:67936838-67936860 CTTGTCTTTTTGATGAAAAAGGG + Intergenic
1193104982 X:77660983-77661005 TTGCTGTAGTTGATGACAAATGG - Intronic
1193137668 X:77991006-77991028 ATTTTTCTGTTGGTGACAAATGG + Intronic
1194252467 X:91593421-91593443 CTTTTATTTTTGATACCAAATGG + Intergenic
1194303317 X:92213290-92213312 CTTTTATTTTTGATTACTAACGG + Intronic
1194331942 X:92593524-92593546 TTTTTGTTGTTGTTGTTAAAGGG + Intronic
1194821825 X:98517737-98517759 CTTTTGTTCATAACGACAAAGGG + Intergenic
1195267943 X:103201828-103201850 TTGTTGTTGTTGTTGACACAGGG + Intergenic
1195312012 X:103640862-103640884 TTTTTGTTGTTGTTGAGACAGGG + Intergenic
1195775684 X:108402767-108402789 TTTTTGTTGTTGACGTCATATGG + Intronic
1196131566 X:112162725-112162747 CGTCTGTTGTAGATGGCAAAGGG - Intergenic
1197164584 X:123362575-123362597 CTTCTGTTGCTGTTGAAAAAAGG - Intronic
1197654063 X:129097347-129097369 CTGTTGTTGTTGTTGAGACAGGG + Intergenic
1198529693 X:137539842-137539864 CTGTTGTTGTTGTTGAGACAGGG + Intergenic
1200571398 Y:4834666-4834688 CTTTTATTTTTGATACCAAATGG + Intergenic
1200640645 Y:5712583-5712605 TTTTTGTTGTTGTTGTTAAAGGG + Intronic
1201519227 Y:14853837-14853859 CTTTTCTTTTTAATGAGAAATGG + Intergenic