ID: 977456178

View in Genome Browser
Species Human (GRCh38)
Location 4:97262878-97262900
Sequence CTCTGTGTATGAAGGGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977456178_977456184 29 Left 977456178 4:97262878-97262900 CCATGGGCCCTTCATACACAGAG 0: 1
1: 0
2: 1
3: 28
4: 150
Right 977456184 4:97262930-97262952 GTGAATCAGTCTTCAAATTTTGG 0: 1
1: 0
2: 2
3: 54
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977456178 Original CRISPR CTCTGTGTATGAAGGGCCCA TGG (reversed) Intronic
900313436 1:2045806-2045828 CTCTGTGAGTGAAGGGTGCAGGG - Intergenic
900964915 1:5951198-5951220 CTCTGTGGGTGCCGGGCCCAAGG + Intronic
905824911 1:41020228-41020250 CTCTGTGGCTGAAGGGCCCTTGG + Exonic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907562815 1:55406464-55406486 CTCTGTGCCTGCAGTGCCCAGGG + Intergenic
908098510 1:60765936-60765958 CTTTGTGAAAGAAGGGCCCTGGG - Intergenic
909156923 1:72090181-72090203 CTCTGTGTGTCAATAGCCCAGGG - Intronic
914352201 1:146850108-146850130 CTCTTTGAAGGCAGGGCCCATGG - Intergenic
917116316 1:171607504-171607526 ATCTGTGTATTAAGGTACCATGG + Intergenic
918990982 1:191696711-191696733 CTCTGTTTATGAAGTGGGCAAGG + Intergenic
920248069 1:204603199-204603221 CATTGTGTATGAAGGCCCAAAGG + Intergenic
920746261 1:208631839-208631861 CTCTGCTTCTGAAGGGACCAGGG - Intergenic
921296183 1:213705761-213705783 CACTGGGTATTCAGGGCCCAAGG + Intergenic
1063156630 10:3385191-3385213 CTCTTTGTATGAAGCTTCCATGG + Intergenic
1063582939 10:7325458-7325480 CTCTGTGTAAGGAAGACCCATGG + Intronic
1063737677 10:8779069-8779091 CTCTGTGTGTGAAGGGCCATGGG - Intergenic
1064119463 10:12606247-12606269 TGCTGTGTGTGAGGGGCCCATGG - Intronic
1065280791 10:24135472-24135494 CTCTGTGTCTAAAGTGCTCAGGG + Intronic
1065990135 10:31001110-31001132 CTTGCTGTATGAAAGGCCCATGG + Intronic
1066654715 10:37687031-37687053 ATCTGTGCATGGAGGGCCCAGGG + Intergenic
1067057625 10:43061501-43061523 CAATGTACATGAAGGGCCCAGGG - Intergenic
1069778259 10:70939175-70939197 AGCTAGGTATGAAGGGCCCATGG + Intergenic
1070777520 10:79118527-79118549 CTCTGTCTTTCAAGGGCCCCTGG - Intronic
1071331287 10:84563633-84563655 CCCTGTGCCTGAAGGTCCCATGG + Intergenic
1072069948 10:91906648-91906670 ATCTGTGGATGCAGAGCCCACGG - Exonic
1075945172 10:126426612-126426634 CACTTTGAATTAAGGGCCCAGGG + Intronic
1077032585 11:476180-476202 AGCTGTGTGGGAAGGGCCCAGGG + Intronic
1082029090 11:47592012-47592034 CTCTGTGCAGGAAGGGCCCCTGG - Intronic
1084165092 11:67371890-67371912 GTCTGTGAATGAAGGGGACAGGG + Intronic
1084264931 11:68000020-68000042 CACTGTGTCTGTAGGGCCCAGGG + Intronic
1085415934 11:76318931-76318953 CTCTGTGTATGCAGCCTCCAGGG - Intergenic
1086037417 11:82433408-82433430 CTCTGTGAATGAAGGGACCAAGG - Intergenic
1086350146 11:85936165-85936187 CTGGGTGGAGGAAGGGCCCAAGG - Intergenic
1090459533 11:126878065-126878087 CTCTGTGAATGAAAGGCCATAGG - Intronic
1090651726 11:128812739-128812761 GTCTGGGTCTGAAGTGCCCAGGG - Exonic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1096263395 12:50106436-50106458 CACTGTGTATGCAGGTGCCAGGG - Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104576577 12:129972118-129972140 CTCAGTGTCAGAATGGCCCACGG - Intergenic
1105382531 13:19901049-19901071 CTCTCTGTATGAATGCACCAAGG - Intergenic
1105737582 13:23287192-23287214 CTCTGGTTATAAAGGGCTCATGG - Intronic
1106329596 13:28727269-28727291 CTCTGTGCATGCAGGGACCATGG + Intergenic
1114531211 14:23397526-23397548 CACCGGGTAAGAAGGGCCCAGGG - Exonic
1115627212 14:35205740-35205762 CTGTGTGTATGAAGCCACCATGG - Intronic
1116295415 14:43100736-43100758 CTCTGTGTAGGAAGGGGCCGGGG - Intergenic
1116493803 14:45536782-45536804 CTCTGTGAATGGAGTGTCCAGGG - Intergenic
1118495711 14:66306335-66306357 CTCTGTGTAGGAAGGGACAAGGG + Intergenic
1121348412 14:93153512-93153534 CACTGTTTATGATGGTCCCACGG - Intergenic
1123071406 14:105644255-105644277 CCCTGTGTGTGAAGGGCCTGGGG + Intergenic
1123096836 14:105770871-105770893 CCCTGTGTGTGAAGGGCCTGGGG + Intergenic
1125731206 15:41893692-41893714 CCCTGTGCTTGAATGGCCCAGGG + Intronic
1127804170 15:62503441-62503463 CTCTGTGTATAAAGCACACATGG - Intronic
1128115709 15:65103687-65103709 CTCTGTATCTTCAGGGCCCAGGG + Intronic
1128866746 15:71120107-71120129 TTTTGTGTCTGAAGGGCACAGGG + Intronic
1129759337 15:78120474-78120496 CTCTGTGTACCAAGGGGACAAGG + Intronic
1130821692 15:87502846-87502868 CTCTGTGTCCAAAGGGCCCAGGG - Intergenic
1131262098 15:90892848-90892870 CTCTGTGTATGCGGGACCCGTGG - Intronic
1131782633 15:95876158-95876180 CACTGCATCTGAAGGGCCCACGG + Intergenic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1135970828 16:27070767-27070789 TGCTGTGTCTGAAGAGCCCATGG - Intergenic
1139981829 16:70865424-70865446 CTCTTTGAAGGCAGGGCCCATGG + Intronic
1140924117 16:79566464-79566486 TTCTGGGAAGGAAGGGCCCATGG + Intergenic
1142148685 16:88503254-88503276 ATCTGTGTCTGGGGGGCCCACGG + Intronic
1142148710 16:88503333-88503355 ATCTGTGTCTGGGGGGCCCACGG + Intronic
1142148732 16:88503408-88503430 ATCTGTGTCTGGGGGGCCCACGG + Intronic
1142148745 16:88503446-88503468 ATCTGTGTCTGGGGGGCCCACGG + Intronic
1142228398 16:88888432-88888454 CTCTGTGTCTGAAGGGGCTGCGG + Intronic
1143680444 17:8472179-8472201 CTCTGGGTATGACCGACCCAGGG - Intronic
1145957161 17:28862437-28862459 CTGTGTTTATGATGAGCCCAAGG + Intergenic
1147211413 17:38874522-38874544 CTCTCTGGAGGAAGGCCCCAAGG - Intronic
1147213200 17:38884144-38884166 CTCTGTGTAGAAAGGGCGCTGGG + Intronic
1147438187 17:40430850-40430872 CTCTGGCCATGAAGGGCCCCAGG - Intergenic
1149051092 17:52306355-52306377 GTCTGTGACTGAAGGCCCCAGGG - Intergenic
1149076273 17:52598603-52598625 CTATGTGTATGCAGGGCACCTGG - Intergenic
1151218393 17:72593005-72593027 GTCTGTGAAGGAAGGGCGCAAGG - Intergenic
1152481871 17:80559637-80559659 CTCTGTGTATGCTGGAACCATGG + Intronic
1154059127 18:11042369-11042391 CTGTGTGTATGAAGTGCACATGG - Intronic
1155087424 18:22471934-22471956 CACTGTGTCTGAAGGGCACTGGG - Intergenic
1156459848 18:37315576-37315598 CTCTGTGTCTGGAGGACCCCAGG + Intronic
1157399965 18:47379034-47379056 CTAACTGAATGAAGGGCCCAAGG - Intergenic
1157447311 18:47755146-47755168 CTCTGTGCACCAGGGGCCCAAGG + Intergenic
1158690521 18:59656007-59656029 CTCTGTGAATGTAGTGACCAGGG + Intronic
1161079473 19:2303383-2303405 GGCTGTGTTTGACGGGCCCAGGG + Intronic
1163382873 19:16980259-16980281 CTCTGTGTGTGCAGGGGACAGGG - Intronic
1163946920 19:20546177-20546199 TTAAGTGTATGAAGGGCCCCAGG + Intronic
1163971845 19:20805604-20805626 TTAAGTGTATGAAGGGCCCAAGG - Intronic
1164059351 19:21654947-21654969 CTAAGTGTATGAAGTGCCCATGG - Intergenic
1164258304 19:23548529-23548551 TTCTGTGTATAATGGGACCAAGG - Intronic
1164880319 19:31727412-31727434 CTCTCTGTTTCAAGGGCTCATGG - Intergenic
925157457 2:1658582-1658604 GGCTGTGGATGAAGGGTCCAGGG - Intronic
926063924 2:9822214-9822236 GTCCGTGTAGAAAGGGCCCAGGG + Intergenic
926705076 2:15831347-15831369 CTTAGGGTATGAAGGGCCCTGGG + Intergenic
928007740 2:27578949-27578971 CTTTGATTATGAAGGGCCAAAGG - Exonic
932469614 2:71945264-71945286 CTCTGCGCATGAAGGGGCCAAGG + Intergenic
933749394 2:85593400-85593422 ATCTGTGTGTGAAGGTCCCCAGG + Exonic
935044648 2:99469562-99469584 CTCTGTCTATGAGGAGCCCAGGG + Intronic
936278279 2:111118804-111118826 CGCAGTGTGAGAAGGGCCCATGG - Intergenic
936516632 2:113185318-113185340 CTCTGTGTATCCAGGGCTCATGG + Intronic
938259555 2:129885450-129885472 CTTTGTATATGAAGTGCTCAAGG - Intergenic
938324408 2:130388719-130388741 ATCTGTGTGTGAGGTGCCCATGG - Intergenic
942894839 2:181040000-181040022 ATCTGTGTATGTAGAACCCATGG + Intronic
942976119 2:182020435-182020457 CTTTGAGCATGAAGGGCCTAAGG + Intronic
943742303 2:191423001-191423023 TTCTGTGTAAGAAGTGCTCATGG + Intronic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
944862301 2:203826493-203826515 TTCTGAGTATGCAGGGCCCTGGG + Intergenic
945995136 2:216430125-216430147 CTCTGTGTGTGAGGCGCCCCAGG + Intronic
947252385 2:228122332-228122354 CACTGTGTGTGAAGAGCCCCTGG - Intronic
948687344 2:239677530-239677552 CTGTGTGTGTGCAGGGGCCAGGG - Intergenic
1170119053 20:12892697-12892719 CTCTGGGAAGGAAGGGACCATGG - Intergenic
1181680982 22:24495584-24495606 CTCAGGGTCTGAAGGGCTCAGGG + Intronic
1182279386 22:29209163-29209185 CTTTGTCTCTGTAGGGCCCAGGG - Intronic
1183095985 22:35552596-35552618 CTCTGTGTCTGAAGGGGGCGTGG + Exonic
1185344135 22:50304080-50304102 CTCTGGGTGTGAAGGGCTCCAGG + Intronic
949466814 3:4352779-4352801 ATCTGTCTGTGAAGGGGCCAGGG + Intronic
950617898 3:14177136-14177158 ATCTGTGGATGCAGGGCCCGTGG - Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
954303317 3:49712827-49712849 CTCTGTGGCTGCAGGTCCCAGGG - Intronic
954642837 3:52112111-52112133 CTTTGGGTTTAAAGGGCCCACGG + Intronic
955494580 3:59518485-59518507 CTCTGTTTATCAAGGGCCAGAGG - Intergenic
956074249 3:65488146-65488168 CTCTGTGGATTCAGGCCCCATGG + Intronic
956453007 3:69392647-69392669 TTCTGTGTGTGAAGGCCCCATGG - Intronic
956696711 3:71924663-71924685 ATCTGTGTCTGCAGGGCTCAAGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
961919759 3:130413604-130413626 CTCTGTGGTTGATGGGACCAAGG + Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
966622455 3:181980636-181980658 CTCTGTGCATGCAGGTACCAAGG - Intergenic
967636691 3:191809447-191809469 CTATGTTTATGCAAGGCCCAAGG - Intergenic
968936331 4:3612343-3612365 CTGTGTGTATGATGGACCGAGGG + Intergenic
977456178 4:97262878-97262900 CTCTGTGTATGAAGGGCCCATGG - Intronic
977945915 4:102913919-102913941 CTCTGTCTAAGCAGGGCACAAGG - Intronic
979871089 4:125822872-125822894 CTGTGAGTCTGAGGGGCCCACGG + Intergenic
984107727 4:175571090-175571112 CTCTGGGGATGAAAGGCACAAGG + Intergenic
984250780 4:177332111-177332133 CTTTGTGTATGTAGAACCCAAGG + Intronic
984874756 4:184357166-184357188 CTCAGCATATGCAGGGCCCAGGG + Intergenic
985604022 5:849161-849183 GGCTGTGTATGCAGGGCCAATGG - Intronic
985918649 5:2948703-2948725 CTTTCTGTCTGCAGGGCCCAGGG + Intergenic
986242107 5:5970467-5970489 CTCTGTGTCTGAAGGCTCCCTGG - Intergenic
990428630 5:55712718-55712740 CTTTGTGTCTGTAGGGTCCAAGG - Exonic
992687949 5:79216409-79216431 ATCTGTATGTGAAGGGCCAAGGG - Intronic
995277302 5:110291712-110291734 CTCTGTTTAGGAAGGGCCTTGGG - Intronic
997702970 5:135917822-135917844 CAGTGAGTATGAAGGCCCCAAGG + Intergenic
999241194 5:150128406-150128428 CTCTGTGTATGCAGGTCCCTGGG - Intronic
1002441725 5:179267735-179267757 CACTGGGTGTGCAGGGCCCAGGG + Intronic
1004051726 6:12088117-12088139 ATCAGAGTTTGAAGGGCCCATGG + Intronic
1006269057 6:32949942-32949964 CTCTGTGTTTGGAGGGGCCATGG + Intronic
1012052634 6:94362622-94362644 CTCTGGGGATGCAGGGCACAGGG + Intergenic
1012815255 6:104016074-104016096 CTCTGTGCATGAAGGGAATATGG - Intergenic
1016818240 6:148323561-148323583 CTCTGTGAAGGGAGGGGCCATGG - Intronic
1017938689 6:159031620-159031642 CTCTGAGTATGAAGGAACCCGGG + Intergenic
1024639962 7:51320503-51320525 CTCTGTGGATGAAGGGGCAAAGG - Intergenic
1026458635 7:70594565-70594587 CTCTGTGTATTCAAGGACCAGGG + Intronic
1026769192 7:73183491-73183513 TTCTTTGTATGAAGGCCCCAAGG - Intergenic
1027010061 7:74736876-74736898 TTCTTTGTATGAAGGCCCCAAGG - Intronic
1027077980 7:75209161-75209183 TTCTTTGTATGAAGGCCCCAAGG + Intergenic
1028879875 7:95868058-95868080 TTCTGTGTAAGAAGGGAGCAAGG + Intronic
1033923934 7:146433217-146433239 CTGTGTGTACAAAGGCCCCAGGG - Intronic
1034537982 7:151737889-151737911 TTCTGTGGATGGAGGCCCCATGG - Intronic
1034538202 7:151739018-151739040 TTCTGTGGATGGAGGCCCCATGG - Intronic
1035056866 7:156041621-156041643 CCCTGTGTCTGGGGGGCCCAGGG - Intergenic
1035093937 7:156336953-156336975 CTCTGAGGATGCAGAGCCCATGG - Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1041835120 8:62203173-62203195 CTTTGTGAATGCAGGGGCCAGGG + Intergenic
1042297918 8:67242525-67242547 CTCTGGCTATTCAGGGCCCAGGG - Intronic
1042758645 8:72246664-72246686 CTGTGAGTTTGAAAGGCCCAGGG - Intergenic
1043078026 8:75727164-75727186 CTCTAAGAATGAAGGGCCAATGG + Intergenic
1046299582 8:112269579-112269601 CTCTGTGTATGATGGGCTCTAGG + Intronic
1047754167 8:127905966-127905988 CTCTGTGTAGGAAGGGTCTGAGG + Intergenic
1049159977 8:141090898-141090920 CTCAGGGTCTGAGGGGCCCAAGG + Intergenic
1049824685 8:144661177-144661199 GCCTGTGTGTGAAGGGGCCATGG - Intergenic
1054919647 9:70529275-70529297 CTTTGTGTATGGATGGACCACGG - Exonic
1057886377 9:98833100-98833122 CTCTGAGTAGAATGGGCCCAAGG + Intronic
1058293956 9:103281347-103281369 CTCTGTTTCTAAAGGGCTCAAGG + Intergenic
1059455878 9:114399863-114399885 GTCAGTGTAGGAAGGGCCCAAGG + Intergenic
1061664441 9:132152205-132152227 CTCTGTGTCTGCAGGGCCTTGGG - Intergenic
1187217941 X:17295279-17295301 CTCTGTGTATGAAGTGGACAAGG + Intergenic
1189257365 X:39650930-39650952 CTCTGTGGATGGTGGGCCCAGGG + Intergenic
1190239463 X:48646178-48646200 CTCTGTGTTTATAGGGCCAAGGG - Intergenic
1198507775 X:137318321-137318343 ATGTCTGTCTGAAGGGCCCATGG - Intergenic
1198733780 X:139763779-139763801 ATCTGTGGATGCAGGACCCATGG + Intronic
1199252796 X:145683401-145683423 CTCTCTCTGTGAAGGCCCCAGGG - Intergenic