ID: 977457734

View in Genome Browser
Species Human (GRCh38)
Location 4:97282769-97282791
Sequence GGGTATTCAATTACAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977457731_977457734 8 Left 977457731 4:97282738-97282760 CCAGGGCAATCAGGCAGGAGAAA 0: 1404
1: 6333
2: 8242
3: 5226
4: 4230
Right 977457734 4:97282769-97282791 GGGTATTCAATTACAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977457734 Original CRISPR GGGTATTCAATTACAAAAAG AGG Intronic
No off target data available for this crispr