ID: 977459986

View in Genome Browser
Species Human (GRCh38)
Location 4:97312907-97312929
Sequence CTATATACCAAGTTGAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
977459983_977459986 0 Left 977459983 4:97312884-97312906 CCATGCAGTCCTTGCTCCTGTAG 0: 1
1: 0
2: 4
3: 29
4: 204
Right 977459986 4:97312907-97312929 CTATATACCAAGTTGAAACTAGG 0: 1
1: 0
2: 0
3: 12
4: 139
977459981_977459986 13 Left 977459981 4:97312871-97312893 CCCTCTGACAATACCATGCAGTC 0: 1
1: 0
2: 1
3: 20
4: 179
Right 977459986 4:97312907-97312929 CTATATACCAAGTTGAAACTAGG 0: 1
1: 0
2: 0
3: 12
4: 139
977459982_977459986 12 Left 977459982 4:97312872-97312894 CCTCTGACAATACCATGCAGTCC 0: 1
1: 0
2: 1
3: 7
4: 128
Right 977459986 4:97312907-97312929 CTATATACCAAGTTGAAACTAGG 0: 1
1: 0
2: 0
3: 12
4: 139
977459984_977459986 -9 Left 977459984 4:97312893-97312915 CCTTGCTCCTGTAGCTATATACC 0: 1
1: 0
2: 0
3: 4
4: 89
Right 977459986 4:97312907-97312929 CTATATACCAAGTTGAAACTAGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
977459986 Original CRISPR CTATATACCAAGTTGAAACT AGG Intronic
907515638 1:54991681-54991703 ACATATACGCAGTTGAAACTTGG - Intronic
907625924 1:56029294-56029316 CTATAAAACAAGTTGAAAATTGG - Intergenic
910823260 1:91374676-91374698 CTATGTACCAAATAGAACCTTGG - Intronic
912744677 1:112235883-112235905 CTAGCTACTGAGTTGAAACTGGG - Intergenic
916236828 1:162597474-162597496 CTTTTTATCAAATTGAAACTTGG + Intronic
916447126 1:164882865-164882887 CTATATACTTAGTTTAAATTTGG + Intronic
919343478 1:196344525-196344547 CTATTTAGCAAGATGATACTTGG + Intronic
920003181 1:202812999-202813021 GTAAATTCCCAGTTGAAACTGGG + Intergenic
1063861101 10:10308365-10308387 CAAAAATCCAAGTTGAAACTTGG + Intergenic
1064553540 10:16525515-16525537 CAATATACTAAGTTGATAGTTGG - Intergenic
1065514973 10:26515886-26515908 CTAGAAACCAAGTTGACACCAGG + Intronic
1068337845 10:55660727-55660749 CCAAATACCCAGTTGATACTGGG + Intergenic
1068621576 10:59188905-59188927 CTAGATTTCAAGTTAAAACTAGG - Intronic
1070201905 10:74215319-74215341 CTTTCTACTAAGTTGAAAGTAGG + Intronic
1074052506 10:109892927-109892949 CTATATCACAGGCTGAAACTCGG + Intronic
1074278554 10:112028519-112028541 CTTTATATCAAGTTCAAAATGGG - Intergenic
1075582142 10:123627994-123628016 CCATGTACAAAGATGAAACTTGG - Intergenic
1075607829 10:123827797-123827819 CTATATAATATCTTGAAACTGGG - Intronic
1076116021 10:127901204-127901226 TTATATACCAGGTAGAAACAAGG + Intergenic
1076351897 10:129821694-129821716 CTTTATATCAAGTTAAAAATAGG - Intergenic
1079599267 11:22291070-22291092 CTATATTTCAAGATGAAATTTGG - Intergenic
1081089860 11:38850191-38850213 CAATCTACCAAGTTTAAACTAGG - Intergenic
1081273172 11:41112491-41112513 CTATATTCCAAATTGAATCAGGG + Intronic
1087973947 11:104520739-104520761 CTATTTTCCAAGTTGAATTTAGG - Intergenic
1095403087 12:41837943-41837965 TTATATGCCCAGTTGAAATTTGG - Intergenic
1097416179 12:59319120-59319142 CAAGAGACCAATTTGAAACTTGG + Intergenic
1099421757 12:82470410-82470432 GTATGGACCAAGTAGAAACTAGG + Intronic
1100672361 12:96830538-96830560 GTATATACCAATTTTAAAATGGG - Intronic
1105244535 13:18636874-18636896 ATATATAGAAAGCTGAAACTGGG + Intergenic
1107184686 13:37505008-37505030 CTTTATATGAAGTTGAAATTTGG - Intergenic
1110097952 13:71555136-71555158 CTATTTACCAAGTTTAACTTGGG - Intronic
1112693822 13:101925642-101925664 TTACATACAAAGTAGAAACTAGG - Intronic
1114071639 14:19114064-19114086 CTTTGTACCAAGTTAAAAGTAGG - Intergenic
1114090622 14:19285904-19285926 CTTTGTACCAAGTTAAAAGTAGG + Intergenic
1114173159 14:20295047-20295069 CTATATCCATAGTTGAAATTTGG - Intronic
1114177724 14:20338219-20338241 CTATCCCCCAAGTTGAACCTAGG + Intergenic
1116370455 14:44123905-44123927 CTATATACAAAGGAGAATCTAGG - Intergenic
1118732790 14:68680851-68680873 TAATATACTAAGTTTAAACTTGG + Intronic
1121763768 14:96467876-96467898 TTATTTACCAAGTTCAAACTGGG + Intronic
1127140245 15:55968993-55969015 CTTGATACGATGTTGAAACTAGG - Intronic
1129437894 15:75556990-75557012 CTATATACCATGATGGACCTTGG - Intronic
1130000322 15:80040693-80040715 ATAGATACCAAATTGAAAATAGG - Intergenic
1131685527 15:94763495-94763517 CTATATAACAAGGTGCAGCTAGG + Intergenic
1131729480 15:95264500-95264522 CTTAATACCAAGAAGAAACTTGG + Intergenic
1138058447 16:53861604-53861626 CTAAATACAAAATTGAAAATTGG - Intronic
1148529701 17:48377986-48378008 CTATCCACCCAGCTGAAACTTGG + Intronic
1150038734 17:61834453-61834475 ATATATACTCAGTTGATACTGGG + Intronic
1154444399 18:14423024-14423046 ATATATAGAAAGCTGAAACTGGG - Intergenic
1156067631 18:33163985-33164007 CTATAAACCAAGTGGAAGCAGGG - Intronic
926558576 2:14389509-14389531 TCATATAGCATGTTGAAACTAGG + Intergenic
927001151 2:18795072-18795094 AAATATACCAAGTAGACACTTGG + Intergenic
928654001 2:33430450-33430472 CTGTAAATCAGGTTGAAACTAGG - Intergenic
929531425 2:42755433-42755455 CTATCTACCCAGTTGACATTTGG + Exonic
932639561 2:73429795-73429817 CTATAGAGCAAGTTGAATTTGGG - Intronic
932834901 2:75027177-75027199 ATTTATACAAAGTTGAAATTAGG + Intergenic
937138065 2:119572564-119572586 CCAGATAACTAGTTGAAACTTGG + Intronic
938395630 2:130945593-130945615 CTCAATACCAGCTTGAAACTGGG - Intronic
941209293 2:162616642-162616664 CTTTACACCACGTTGAAACTTGG + Intronic
942395126 2:175539031-175539053 CTATACACCAAGTTGTTATTTGG - Intergenic
944057235 2:195535610-195535632 GTATATGCCATGTTTAAACTAGG - Intergenic
945824418 2:214703048-214703070 CAATATACCAAGATGAAACCAGG + Intergenic
1170704649 20:18734348-18734370 CTCTATACGAAGTTGACACATGG + Intronic
1173280634 20:41623874-41623896 CTATGTGCCAAGTTAAAAATTGG + Intergenic
1173477381 20:43370522-43370544 ATATATAGAAAGCTGAAACTGGG + Intergenic
1176451582 21:6866841-6866863 ATATATAGAAAGCTGAAACTGGG + Intergenic
1176829750 21:13731892-13731914 ATATATAGAAAGCTGAAACTGGG + Intergenic
1177539714 21:22476974-22476996 CTTGATACTAAGTTAAAACTAGG - Intergenic
1177601708 21:23323892-23323914 ATAAATACCAAGTTGAGTCTAGG + Intergenic
1179266820 21:39810913-39810935 CCACACAGCAAGTTGAAACTAGG - Intergenic
1182815895 22:33163266-33163288 CTATTTACCAATTTGTCACTTGG + Intronic
1183262253 22:36803247-36803269 CTCTATACCAAGGTCAAAGTAGG - Intronic
1184414185 22:44342647-44342669 CTGGACACCAAGTTGAAACCTGG - Intergenic
951479925 3:23149257-23149279 CTACATACCAAGTAGAAAACAGG + Intergenic
951485011 3:23201974-23201996 CTATTTACTAAGTTCAAAATGGG - Intergenic
952708889 3:36408849-36408871 GTTTAGACCAGGTTGAAACTTGG + Intronic
956420022 3:69078187-69078209 CAATATCCTAAGTTGAACCTTGG - Intronic
956559281 3:70555901-70555923 CTATATAGTAATTTGAAACTGGG - Intergenic
956605142 3:71065939-71065961 CTATTTACCACCTTCAAACTTGG + Intronic
957200416 3:77127517-77127539 CTATTTACCAACTTGAAAGAAGG + Intronic
959005069 3:101010809-101010831 GTATATAGGAAGTTGAAACCTGG + Intergenic
959250307 3:103933419-103933441 CTATGTAGAAAGCTGAAACTGGG + Intergenic
965309892 3:167115603-167115625 CTACAGACCAAGTGGAAACCTGG - Intergenic
966557087 3:181274815-181274837 CTATATACCTTATTAAAACTTGG - Intergenic
967432901 3:189408169-189408191 ATATATACAAATTTAAAACTTGG + Intergenic
971906776 4:32736311-32736333 CTTTATAACAAGTTGAAGTTAGG - Intergenic
973834827 4:54798758-54798780 ATATATAGAAAGCTGAAACTGGG - Intergenic
974067602 4:57094319-57094341 CTACTTGCCAAGTGGAAACTGGG + Intronic
975393594 4:73849042-73849064 CCATGTACTATGTTGAAACTAGG - Intronic
975852389 4:78585567-78585589 CAATGTACCAAGTTAAAAGTTGG + Intronic
977459986 4:97312907-97312929 CTATATACCAAGTTGAAACTAGG + Intronic
978837197 4:113165166-113165188 CTATCTAGCTAGTTGAAAATTGG + Intronic
980426050 4:132629268-132629290 ATATGTAGAAAGTTGAAACTGGG + Intergenic
980711106 4:136569215-136569237 CTATATATCAAGGAGAATCTTGG + Intergenic
981359743 4:143832361-143832383 CTATAAATCAAGATGAAATTTGG - Intergenic
983167196 4:164492446-164492468 TTATAGACCAAGTTGGAATTAGG + Intergenic
987629576 5:20451070-20451092 CTATAATTCAAGTTGAGACTTGG + Intronic
988172700 5:27680330-27680352 ATATATAGAAAGCTGAAACTGGG + Intergenic
988423380 5:31034013-31034035 CTATAGAATAAGTTAAAACTGGG + Intergenic
988670073 5:33371739-33371761 CTATTTACATAGTTGTAACTTGG - Intergenic
989668352 5:43883422-43883444 CTATATACCAAATTGTTACTTGG + Intergenic
993462888 5:88207330-88207352 CCATATACTAAGTTGTAGCTAGG + Intronic
994695008 5:103062898-103062920 CTATATACCTACCTGAGACTGGG - Intergenic
995393315 5:111662327-111662349 CTACAAATCAAGTTGAAATTTGG + Intergenic
995614934 5:113951264-113951286 CTATATACCAAACTGCAACTCGG - Intergenic
996132166 5:119794852-119794874 ATATATAGAAAGCTGAAACTGGG - Intergenic
998238007 5:140416596-140416618 CTTTATAGTAAGTTGAAATTAGG + Intronic
999273021 5:150308931-150308953 CTCGATACCAAATTGAAATTCGG + Intronic
999890411 5:155973026-155973048 CTATATAACAATTTTAAAATTGG - Intronic
1004086207 6:12452062-12452084 ATATATACCAAGTGGACAATTGG + Intergenic
1006893886 6:37453580-37453602 TTATTTTCCAAATTGAAACTTGG + Intronic
1007862346 6:44924877-44924899 GTAAATACCAAGTAGAAATTGGG - Intronic
1007991875 6:46264838-46264860 CTATATGCCAAGTCCACACTAGG + Intronic
1012936406 6:105372434-105372456 CTACATACCACGTTGAAATGTGG + Intronic
1014459606 6:121680529-121680551 CTATATCTTGAGTTGAAACTAGG - Intergenic
1015775505 6:136809909-136809931 CTATAGACCACTTTGATACTGGG - Intergenic
1015784379 6:136905911-136905933 CTCAATACCAAGTTGAATTTAGG - Intronic
1016113552 6:140256156-140256178 CTATATAAAAAGGTGAAATTTGG + Intergenic
1017452697 6:154568735-154568757 CTATATACTAAGTTCAAACATGG + Intergenic
1018046951 6:159973837-159973859 TTATATACCAAGATCAAAATAGG - Intronic
1019754119 7:2756046-2756068 CTTTCTAGCAAGTTGAAAGTTGG - Intronic
1023238378 7:38115111-38115133 CGATATAGCCAGTTGATACTGGG - Intergenic
1023952538 7:44858231-44858253 CAACATACCCAGTTGAAAATGGG - Intergenic
1024725879 7:52193977-52193999 CTATATACCACTTTTAAAATGGG + Intergenic
1028997951 7:97122435-97122457 GTATATACCTATTTGAGACTGGG - Intronic
1031372460 7:120984780-120984802 GTATATGCCAATTTGAAGCTTGG + Intergenic
1031790279 7:126093669-126093691 CTATAATCCAAGATGAAATTTGG + Intergenic
1032244785 7:130201588-130201610 CTTTAAAACAAGTTGAAACAAGG - Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1037381586 8:18290975-18290997 ATATGTACAAAGTAGAAACTTGG + Intergenic
1039947043 8:42139142-42139164 TTATATACCATTTTGTAACTAGG + Intergenic
1045073340 8:98534733-98534755 CTATATTCAGAATTGAAACTCGG + Intronic
1045662202 8:104449652-104449674 CCTTATATCAAGTGGAAACTGGG + Intronic
1046628834 8:116603507-116603529 CCAGACACTAAGTTGAAACTAGG - Intergenic
1051399685 9:16666684-16666706 TTAGATACCATGTTTAAACTAGG - Intronic
1052099020 9:24420858-24420880 CTTTATACCAATTTGAAATTGGG - Intergenic
1052294410 9:26881352-26881374 CTACAATTCAAGTTGAAACTTGG - Intronic
1052568595 9:30190572-30190594 CAATATACAAAGTTGAACCAGGG - Intergenic
1052661834 9:31443202-31443224 CTTTATAATAAGTTGAAATTGGG - Intergenic
1203517599 Un_GL000213v1:17676-17698 ATATATAGAAAGCTGAAACTGGG - Intergenic
1189549281 X:42076533-42076555 CTATATGCTCACTTGAAACTTGG + Intergenic
1190833069 X:54076550-54076572 CTATAAACCAAGTTGAAATGAGG + Intronic
1191191771 X:57675504-57675526 GTGTATACCAAGTTAAAAATGGG - Intergenic
1191216829 X:57941235-57941257 ATATGTACAAAGCTGAAACTGGG - Intergenic
1193432339 X:81423848-81423870 ATACAGACCAAGTTCAAACTTGG - Intergenic
1193536682 X:82725681-82725703 CTAAATACCATGTTGATATTTGG + Intergenic
1195508178 X:105683506-105683528 CTATATTGGAAATTGAAACTGGG - Intronic
1197434646 X:126411016-126411038 CAATATACAAAGTTGTAAATTGG + Intergenic
1198376618 X:136047200-136047222 CTATATACCTAGTGGAAAAGGGG + Exonic
1199448255 X:147952141-147952163 CTATGTACCATAATGAAACTGGG + Intergenic
1201266358 Y:12210894-12210916 CTAGAAACCAAGTTGACACTAGG + Intergenic
1201850763 Y:18477272-18477294 TTATAAAACAAGTTGAAATTGGG + Intergenic
1201882555 Y:18843105-18843127 TTATAAAACAAGTTGAAATTGGG - Intergenic